Presentations & Public Speaking

11 pages
3 views

Petunia actin-depolymerizing factor is mainly accumulated in vascular tissue and its gene expression is enhanced by the first intron

of 11
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Share
Description
Petunia actin-depolymerizing factor is mainly accumulated in vascular tissue and its gene expression is enhanced by the first intron
Transcript
  Petunia actin-depolymerizing factor is mainly accumulated in vasculartissue and its gene expression is enhanced by the first intron Jeong-Hwan Mun a,1 , So-Young Lee a , Hee-Ju Yu b , Young-Min Jeong a , Mi-Young Shin a ,Hoyeun Kim a , Ilha Lee a , Sang-Gu Kim a, * a School of Biological Sciences, Seoul National University, Seoul 151-742, South Korea b  National Horticultural Research Institute, RDA, Suwon 440-310, South Korea Received 18 December 2001; received in revised form 2 April 2002; accepted 22 April 2002Received by W. Martin Abstract Actin-depolymerizing factor (ADF) is one of the actin cytoskeleton-modulating proteins. We have characterized the accumulation patternof petunia ADF proteins. PhADF proteins are accumulated in every petunia organ and their accumulation is differentially regulated bydevelopmental signals. Their cellular localization is vascular tissue-preferential in vegetative organs, whereas somewhat different inreproductive organs. In reproductive organs, PhADFs are present in outer integument, endocarp of ovary wall, transmitting tissue of style, and epidermis and endothecium of young anther. From a petunia genomic library, we have isolated a genomic clone encoding PhADF1 . Comparison to complementary DNA sequence revealed that the coding region of   PhADF1  gene consists of three exons andtwo introns. Analysis of chimeric gene expression using b -glucuronidase as a reporter gene in transgenic  Arabidopsis  revealed that  PhADF1 was strongly expressed in every vegetative tissue except petal. In addition, expression of the gene was highly enhanced by its first intron.These results suggest that  PhADF1  gene of petunia is mainly expressed in vascular tissues and its expression is regulated by intron-mediatedenhancement mechanism. q 2002 Elsevier Science B.V. All rights reserved. Keywords : Actin-depolymerizing factor; Vascular tissue; Gene expression; Intron-mediated enhancement 1. Introduction Actin microfilaments are essential cytoskeletal elementsin eukaryotic cells. The remodeling of actin microfilamentsin response to internal or external signals is involved in celllocomotion, cell shape change, cytoplasmic streaming, celldivision, cell elongation, and development (Bamburg et al.,1999; Meagher et al., 1999; Balusˇka et al., 2001). The reor-ganization of the actin network in the cell is modulated byseveral kinds of actin-binding proteins, such as cross-link-ing proteins, severing proteins, capping proteins, and depo-lymerizing proteins (Ayscough, 1998; Carlier, 1998). In plants, actin-depolymerizing factor (ADF) and profilinhave been identified and characterized (Staiger et al., 1997).Plant ADF is a low molecular weight (ca. 16 kD) actin-binding protein of the ADF/cofilin group that includesdestrin, cofilin, actophorin, and depactin (Staiger et al.,1997; Lappalainen et al., 1998). The interaction betweenactin and ADF is regulated by phosphorylation, pH, andphosphoinositide (Lopez et al., 1996; Gungabissoon et al.,1998; Smertenko et al., 1998; Mun et al., 2000; Allwood et al., 2001). In addition, ADF increases the turnover rate of actin filaments (Carlier et al., 1997) and acts synergisticallywith profilin (Didry et al., 1998). ADF is encoded by smallmultigene families in plants (Lopez et al., 1996; Mun et al.,2000; Dong et al., 2001). In monocots, each family can bedivided into two classes that differ in their expressionpatterns: the pollen-specific and vegetative classes of ADFproteins (Kim et al., 1993; Lopez et al., 1996). However, although monocot ADF proteins are functionally distinct(Smertenko et al., 2001), the functional divergence of dicot ADF proteins is uncertain (Mun et al., 2000). In petu-nia and  Arabidopsis , expression patterns of vegetative classgenes were reported (Mun et al., 2000; Dong et al., 2001).Nuclear genes in plants are primarily regulated at thetranscriptional level, and their promoters consist of multiple Gene 292 (2002) 233–2430378-1119/02/$ - see front matter q 2002 Elsevier Science B.V. All rights reserved.PII: S0378-1119(02)00646-7www.elsevier.com/locate/geneAbbreviations: ADF, actin-depolymerizing factor; CTAB, hexadecyltrimethylammonium bromide; GUS,  b -glucuronidase; IME, intron-mediated enhancement; PCR, polymerase chain reaction; UTR, untrans-lated region* Corresponding author. Tel.: 1 82-2-880-6677; fax: 1 82-2-878-7256. E-mail address:  kimsg@plaza.snu.ac.kr (S.-G. Kim). 1 Present address: Department of Plant Pathology, UC Davis, CA 95616,USA.  sequence modules that respond to ubiquitous, developmen-tally regulated, or inducible transcription factors (Donath etal., 1995). The regulatory elements are commonly located inthe promoter and 5 0 -untranslated region (UTR). However,recent studies have demonstrated that some introns have ahigh enhancement effect on gene expression in plants.Usually, the magnitude of intron-mediated enhancement isgreater in monocots than dicots. Although it is not certainhow introns positively affect gene expressions, someevidences suggest that introns increase messenger RNA(mRNA) accumulation by a posttranscriptional mechanism,such as facilitating mRNA maturation or by enhancing thestability of transcripts (Rose and Beliakoff, 2000).We have previously reported the expression characteris-tics of two complementary DNAs (cDNAs) encoding petu-nia ADF. These genes are abundantly expressed in everyplant organ except pollen. In addition, they are highly activein mature vegetative tissue (petal, leaf, and stem) and theirexpression is differentially regulated by developmentalsignals (Mun et al., 2000). In this study, we report the loca-lization patterns of PhADF proteins in petunia and the isola-tion and characterization of the petunia ADF gene, PhADF1 . We have used immunocytochemistry to identifythe cellular localization of PhADF proteins. In addition, wehave analyzed  b -glucuronidase (GUS) expression in trans-genic  Arabidopsis  plant carrying various kinds of  PhADF1::GUS   chimeric genes to verify the expressionpattern of   PhADF1  gene. From this analysis, we havedemonstrated that the  PhADF1  protein is mainly accumu-lated in vascular tissues and its expression is stronglyenhanced by the  fi rst intron. 2. Materials and methods 2.1. Plant material The self-fertile tetraploid  Petunia hybrida  Vilm. cv.Comench (2n  ¼  4x  ¼  28), which was regenerated fromdiploid (2n  ¼  14) calluses derived from mesophyll proto-plasts, was grown under standard greenhouse conditions(Oh and Kim, 1988). Plant samples were harvested at the fl owering stage and stored at 2 80 8 C. 2.2. Polyclonal antibody preparation and immunoblot analysis Expression and puri fi cation of recombinant-PhADFproteins were performed according to Mun et al. (2000).Polyclonal antisera were raised in mice with 100  m g of re-PhADF proteins, suspended in Freund ’ s incomplete adju-vant (Sigma), at 14-day intervals. Total protein extractsfrom various petunia tissues were separated on 12% sodiumdodecyl sulfate-polyacrylamide gel electrophoresis andtransferred onto nitrocellulose membranes (HybondPVDF, Amersham). Blots were incubated with anti-PhADF polyclonal antibodies at a dilution of 1:1000 andthen incubated with secondary antibody (Sigma) at a dilu-tion of 1:5000. The membranes were assayed using ECL-Plus Reagent (Amersham). 2.3. Immunofluorescence assay Tissue samples of petunia roots, stems, leaves, and  fl owerswere prepared according to Cox and Goldberg (1988). Tissuesections(10 m mthick)blockedin2.5%(w/v)non-fatdrymilk (Sigma) were incubated with anti-PhADF polyclonal antibo-dies at a dilution of 1:100 for 1 h and then incubated withFITC-conjugated secondary antibody (Sigma) at a dilutionof 1:40 for 1 h. Mounted slides were examined for immuno- fl uorescence under a confocal scanning laser microscope(MRC-1024, Bio-Rad). The  fl uorescent signal was obtainedand pseudocolored in green. Final  fi gures were composedusing Adobe Photoshop version 5.0 (Adobe System Inc.). 2.4. Genomic library construction and isolation of thegenomic clone For construction of a genomic library, genomic DNAfrom leaves of petunia was isolated by CTAB extractionand further puri fi ed by CsCl/EtBr ultracentrifugation. Puri- fi ed DNA was partially digested with  Sau 3AI, size-fractio-nated (15 – 23 kb) on sucrose gradients, and then cloned intothe  Xho I site of   l FIXII vector (Stratagene) according to themanufacturer ’ s directions.About 6 £ 10 5 recombinant phages were screened using a 32 P-labeled petunia  PhADF1  cDNA clone. After a secondround of screening, genomic DNA inserts from positiveclones were mapped with restriction enzymes andsubcloned into the pBluescriptII SK vector (Stratagene).Overlapping subclones were generated using the NestedDeletion Kit (Pharmacia). Manual nucleotide sequencingwas performed by the dideoxy-nucleotide chain terminationmethod on double-stranded plasmid DNA using the Seque-nase (version 2.0), DNA-Sequencing Kit (USB), and [ a - 35 S]dATP (Amersham) as a label. Sequence data were analyzedwith programs in the DNASTAR package (DNASTAR,Madison, WI) and internet PLACE site (http:// www.dna.affrc.go.jp). 2.5. Primer extension analysis The transcription start sites of the genomic clones weredetermined by primer extension.  32 P-end labeled 28 basesynthetic oligonucleotide primer, PhADF1-PE (Table 1)complementary to nucleotides  1 57 – 1 84 of the  PhADF1 gene, was hybridized to 10  m g of total RNA prepared frompetunia leaf. The  fi rst strand cDNAs were synthesized usingPrimer Extension System (Promega). The products from theprimer extension and sequence reaction were separatedthrough a 6% denaturating polyacrylamide gel. 2.6. Construction of the chimeric genes Schematic diagrams of chimeric constructs are repre-  J.-H. Mun et al. / Gene 292 (2002) 233–243 234  sented in Figs. 4 and 6. Promoter fragments of   PhADF1 were generated by polymerase chain reaction (PCR).Primers used in PCR reactions are represented in Table 1.For construction of   PhADF1  promoter fusions, the 1.7 kbpromoter region with 5 0 -UTR (PA101) and the 3.3 kbpromoter with intron 1 (PA102) were ampli fi ed using thesense primer PA101-F and the antisense primers PA101-Ror PA102-R, respectively. The PCR products were clonedinto the pGEM-T easy vector (Promega) and veri fi ed bysequencing. The resulting vectors were digested with  Bam HI, and DNA fragments were then inserted intopBI101 (Clontech).For construction of PA102.1, PA105, and PAC1,  Bam HIsites were generated at both ends of the fragment containingintron 1 of   PhADF1  by PCR, using the sense primer PA105-F and the antisense primer PA102-R. The ampli fi ed and thencloned PCR fragment was digested with  Bam HI andinserted into PA101, pBI101, and pBI121 (Clontech),respectively. The orientation of the intron in PA102.1,PA105, and PAC1 was veri fi ed by restriction enzyme diges-tion. Similarly, PA103 and PA104 were constructed by PCRusing the sense primers PA101-F or PA104-F and the anti-sense primer PA103-R. The ampli fi ed fragments werecloned into  Bam HI site of pBI101 and PA102, respectively.The  PhADF promoter::GUS   fusion constructs were trans-formed into  Agrobacterium tumefaciens  C58C1Rif  1 by thefreeze-thaw method (An et al., 1988). 2.7. Plant transformation and histochemical analysis For plant transformation,  Arabidopsis  ecotype Columbiawas used. Plants were grown on rock-wool bricks wateredwith MS solution under constant white- fl uorescent light at22 8 C.  Arabidopsis  plants with 2 – 3 in fl orescences weretransformed using the  fl oral-dip method (Clough and Bent,1998). Transgenic lines were selected on 0.5 £ MS/0.8%tissue culture agar plate with 50 mg/l kanamycin. The T 1 transgenic plants were self-fertilized, and T 2  seeds werescreened for segregation on plates containing kanamycin.Candidates with single T-DNA insertion were veri fi ed bySouthern blot analysis, and homozygous T 3  seeds fromseveral independent transformant plants were used forfurther characterization.Histochemical analysis of GUS activity was performed asdescribed by Stomp (1992) at 37 8 C for 12 h. Tissues werecleared of chlorophyll in ethanol. Photographs were takenusing a stereomicroscope. Fluorometric analysis wasperformed as described by Jefferson (1987) using 4-methy-lumbelliferyl- b -glucuronide. GUS values were expressed aspmol 4-methylumbelliferone min 2 1 mg soluble protein 2 1 . 3. Results 3.1. PhADF proteins are mainly accumulated in vascular tissues of petunia To characterize the tissue distribution patterns of PhADFproteins, we have raised polyclonal antibodies againstPhADF1 and PhADF2, respectively, and performed immu-noblot analysis. However, anti-PhADF1 and anti-PhADF2polyclonal antibodies were able to cross-hybridize not onlyto PhADF1 but also to PhADF2 protein (data not shown).Western blotting of tissue extracts showed that the PhADFproteins were expressed at comparable levels in every tissueof mature petunia organs analyzed except anthers (Fig. 1A).The accumulation patterns of PhADF proteins in reproduc-tive (anther) and vegetative tissues (petal and leaf) duringpetunia organ development were examined in detail (Fig.1B). Flower development was categorized according tomaturity as stages 1 – 8. During  fl oral development, thePhADF proteins in anther accumulated at comparable levelsin the young bud stages (anther 1, 2). After anther opening,PhADF proteins were not detected. However, as petalsdeveloped, PhADF protein levels were high in the elongatedbud stage (petal 5) and persisted to the expanded stage (petal7). Interestingly, a minor band of 20 kD was detected inpetals, which re fl ects the existence of an isotype. Similarexpression patterns were observed during leaf development.Leaves were categorized by their position from the shootapex (leaf 1 – 8). PhADF proteins were expressed early inleaf development and gradually increased, being present athigh levels in fully expanded leaves (leaf 6), and then dimin-ished in old leaves. The protein accumulation patterns werein agreement with the tissue distribution of mRNAs that wehave previously reported (Mun et al., 2000). This result  J.-H. Mun et al. / Gene 292 (2002) 233  –  243  235Table 1Oligonucleotides used in PCR, primer extension and GUS fusion construction a Name Sequence Location ExperimentPhADF1-PE 5 0 - CATTTTGAGTTTGTAGTGGATAGAACCA -3 0 1 57 – 1 84 of   PhADF1  Primer extensionPA101-F 5 0 - GGGCCAACA GGATCC  TCTCATT -3 0 2 1581 – 2 1560 of   PhADF1  Construction of PA101-R 5 0 - GGATCC  TTTGAGTTTGTAGTGGATAGA -3 0 1 60 – 1 87 of   PhADF1  PA101, PA102, PA102.1PA102-R 5 0 - GGATCC  AGACGCTGCATTAGCCTATAC -3 0 1 1748 – 1 1764 of   PhADF1  PA103, PA104, PA105PA103-R 5 0 - GGATCC  CCTTGCTGTGTCAGGGCACC -3 0 1 2090 – 1 2114 of   PhADF1  and PAC1PA104-F 5 0 - GGATCC  GCATGGTATAACTAATGTTC -3 0 1 1999 – 1 2024 of   PhADF1 PA105-F 5 0 - GGATCC  ATCCACTACAAACTCAAAATG -3 0 1 58 – 1 84 of   PhADF1 a ‘ F ’  and  ‘ R ’  designate forward and reverse orientation oligonucleotides, respectively.  ‘ 1 ‘  and  ‘ 2 ‘  represent upstream and downstream from thetranscription initiation site. The sequences in italic were synthetic extensions or modi fi ed sites for restriction enzyme digestion.  suggests that ADF gene expression in petunia is regulated atthe transcriptional level.For analysis of the spatial distribution of the PhADFproteins in petunia tissues, immunocytochemical studieswere performed (Fig. 2). In vegetative organs, high levelsof PhADF accumulation could be observed mainly in thevascular tissue, particularly in xylem and phloem (Figs. 2E – G). Weak signals were detected in cortex and mesophyllcells. However, in reproductive organs, PhADF proteinaccumulation patterns were complex. In petals, PhADFswere detected in vascular tissue at high levels (Fig. 2H).In pistils, PhADFs were expressed in the outer integumentof the ovule and endocarp of the ovary wall (Fig. 2Q), thetransmitting tissue of style (Fig. 2R), and the stigma (Fig.2S). In young anthers, strong signals were observed in theepidermis, endothecium, and pollen (Fig. 2T). However, inmature anthers, no signal was observed (data not shown).Weak expression was also detected in the vascular bundlesof the style and anther. 3.2. Isolation of the PhADF1 gene and characterization of its structure A genomic library was constructed with  l FIXII phageand partially  Sau 3AI-digested DNA fragments preparedfrom petunia. A total of 6 £ 10 5 independent clones werescreened by plaque hybridization with the  PhADF1  cDNAas a probe and  fi ve positive clones were isolated. Based onrestriction enzyme digestion and Southern hybridization,one clone was  fi nally selected for further analysis. A 5.5kb  Sal I fragment of the clone was subcloned into pBlue-scriptII SK (Fig. 3A). This clone contained a portion of ADFgene which covers the entire  PhADF1  cDNA sequences.The complete nucleotide sequences of the genomic clonewas determined. The transcribed region of   PhADF1 (GenBank Accession No. AY038063) has a length of 2432 bp, and the 5 0 - and 3 0 -UTRs are 82 and 191 bp long,respectively. The coding region of   PhADF1  is divided intothree exons interrupted by two introns (Fig. 3A). Sequencecomparison revealed that the gene structures between PhADF1  and  Arabidopsis AtADF1  are conserved. The1659 bp  fi rst intron was located immediately downstreamof the start codon, and the 80 bp second intron split codon90. The consensus splicing sequence at the 5 0 exon/intron junction, Ggt, and 3 0 to the end of intron, agG, were found(Hanley and Schuler, 1988). The AT contents of the fi rst andsecond introns are 64 and 74%, respectively. The transcrip-tion start site of   PhADF1  gene was determined by primerextension (Fig. 3B). Sequences similar to  cis -regulatoryelements from eukaryotic promoters are found in the 5 0 - fl anking region. The putative TATA box ( 2 30 – 2 25) isfound at position 30 bp upstream from the transcriptioninitiation site. Thirty-nine nucleotides upstream from theTATA, a putative CAAT box ( 2 71 – 2 66) is found (Fig.3C). Several potential transcription factor-binding sites andhormone response domains were detected (data not shown).This  fi nding suggests that transcription of the  PhADF1  genemay be in fl uenced by a variety of genetic elements. A puta-tive poly(A) addition signal consisting of an AATGAAAsequence was located at 42 bp downstream from the stopcodon.Examination of the nucleotide composition of   PhADF1 gene in the 5 0 -UTR and upstream region of the  fi rst intronrevealed many stretches rich in C/T sequences (Fig. 3C). Inthe actin genes of soybean and rice, the C/T repeatsequences play an important role in controlling actin geneexpression (Huang et al., 1997). The  fi rst intron immedi-ately 3 0 to the initiation codon has also been observed inthe  Arabidopsis AtADF1  gene. Based on position, the intronis similar to the leader introns in several plant genes. The  J.-H. Mun et al. / Gene 292 (2002) 233  –  243 236Fig. 1. Immunoblot detection of PhADF proteins by polyclonal antibody.(A) Immunoblot analysis of anti-PhADF polyclonal antisera with totalprotein extracted from various organs of petunia. The bottom panelshows the Coomassie blue-stained 1-D gel blot of total protein extractsfrom various petunia tissues. Total protein extracts (20  m g per lane) wereprepared from roots, stems, leaves, sepals, petals, anthers, ovaries, andpistils. Molecular mass is indicated on the right-hand margin of thepanel. (B) Expression patterns of PhADF proteins in reproductive (anther)and vegetative tissues (leaf and petal) during petunia organ development.Developmental stages of anthers and petals were categorized according tosize and maturity of  fl ower as follow: 1, 0.1 cm of bud; 2, 0.2 cm of bud; 3,0.5 cm of bud; 4, 1 cm of bud; 5, 3 cm of bud; 6,  fl ower before opening; 7,fully bursting  fl ower; and 8, senescent  fl ower. Developmental stages of leaves were categorized by position from the apex as follows: 1, the smal-lest leaf just below the apical bud; 2, the second leaf from the apex; 3, thethird leaffrom the apex; 4, the forth leaffrom the apex; 5, the  fi fth leaffromthe apex; 6, fully expanded sixth leaffrom the apex; 7, the seventh leaffromthe apex; and 8, senescent leaf.  leader introns of polyubiquitin genes and the rice  Act1  actingene enhanced gene expression in transgenic plants (Zhanget al., 1991; Garbarino et al., 1995). This result suggests thatthe  fi rst intron of   PhADF1  gene may have an important rolein regulating ADF gene expression. 3.3. Expression of PhADF1 in transgenic Arabidopsis To examine the cellular expression of   PhADF1  gene, wefused GUS coding region to the  PhADF1  promoter. Twokinds offusion constructs linking each promoter to the GUS  J.-H. Mun et al. / Gene 292 (2002) 233  –  243  237Fig. 2. Immunocytochemical localization of PhADF proteins in petunia. Sections (10  m m thick) were treated with anti-PhADF polyclonal antisera; antibodybinding was detected with an anti-mouse IgG-FITC conjugate. (A – D, M – P) light microscopic images. (E – H, Q – T) Confocal laser scanning microscopicimages. (I – L, U – X) Control  fl uorescent images with second antibody. (A, E, I) Cross section of root. (B, F, J) Cross section of stem. (C, G, K) Cross section of leaf. (D, H, L) Cross section of petal. (M, Q, U) Cross section of ovary. (N, R, V) Cross section of style. (O, S, W) Longitudinal section of stigma. (P, T, X)Cross section of young anther in 0.2 cm fl ower bud. V, vascular bundle; C, cortex; P, phloem; Pi, pith; X, xylem; O, ovule; Ec, endocarp; T, transmitting tissue;En, endothecium; Ep, epidermis; and P, pollen. Bars ¼ 100  m m.
Related Documents
View more...
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks