Funny & Jokes

8 pages
36 views

NADPH Phagocyte Oxidase Knockout Mice Control Trypanosoma cruzi Proliferation, but Develop Circulatory Collapse and Succumb to Infection

of 8
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Share
Description
NADPH Phagocyte Oxidase Knockout Mice Control Trypanosoma cruzi Proliferation, but Develop Circulatory Collapse and Succumb to Infection
Transcript
  NADPH Phagocyte Oxidase Knockout Mice Control Trypanosoma cruzi   Proliferation, but Develop CirculatoryCollapse and Succumb to Infection Helton C. Santiago 1 . ¤ a , Claudia Z. Gonzalez Lombana 1 . ¤ b , Juan P. Macedo 1 , Lara Utsch 1 , Wagner L.Tafuri 2 , Maria Jose´  Campagnole-Santos 3 , Rosana O. Alves 4 , Jose´  C. F. Alves-Filho 5 , Alvaro J. Romanha 4 ,Fernando Queiroz Cunha , Mauro M. Teixeira , Rafael Radi 5 1 6 , Leda Q. Vieira 1,7 * " 1 Departamento de Bioquı´mica e Imunologia, Instituto de Cieˆncias Biolo´gicas, Universidade Federal de Minas Gerais, Belo Horizonte, Minas Gerais, Brazil,  2 Departamentode Patologia Geral, Instituto de Cieˆncias Biolo´gicas, Universidade Federal de Minas Gerais, Belo Horizonte, Minas Gerais, Brazil,  3 Departamento de Fisiologia e Biofı´sica,Instituto de Cieˆncias Biolo´gicas, Universidade Federal de Minas Gerais, Belo Horizonte, Minas Gerais, Brazil,  4 Centro de Pesquisas Rene´ Rachou, Fiocruz, Belo Horizonte,Minas Gerais, Brazil,  5 Departmento de Bioquı´mica e Imunologia, Faculdade de Medicina de Ribeira˜o Preto, Universidade de Sa˜o Paulo, Ribeira˜o Preto, Brazil, 6 Departamento de Bioquı´mica, Universidad de la Repu ´blica, Montevideo, Uruguay,  7 Nu´ cleo de Pesquisas emOuro Preto, Minas Gerais, Brazil, Abstract N NO is considered to be a key macrophage-derived cytotoxic effector during  Trypanosoma cruzi   infection. On the otherhand, the microbicidal properties of reactive oxygen species (ROS) are well recognized, but little importance has beenattributed to them during  in vivo  infection with  T. cruzi.  In order to investigate the role of ROS in  T. cruzi   infection, micedeficient in NADPH phagocyte oxidase (gp91  phox  2 / 2 or  phox   KO) were infected with Y strain of   T. cruzi   and the course of infection was followed.  phox   KO mice had similar parasitemia, similar tissue parasitism and similar levels of IFN- c  and TNF inserum and spleen cell culture supernatants, when compared to wild-type controls. However, all  phox   KO mice succumbedto infection between day 15 and 21 after inoculation with the parasite, while 60% of wild-type mice were alive 50 days afterinfection. Further investigation demonstrated increased serum levels of nitrite and nitrate (NOx) at day 15 of infection in  phox   KO animals, associated with a drop in blood pressure. Treatment with a NOS2 inhibitor corrected the blood pressure,implicating NOS2 in this phenomenon. We postulate that superoxide reacts with  N NO in vivo, preventing blood pressuredrops in wild type mice. Hence, whilst superoxide from phagocytes did not play a critical role in parasite control in the  phox  KO animals, its production would have an important protective effect against blood pressure decline during infection with T. cruzi  . Citation:  Santiago HC, Gonzalez Lombana CZ, Macedo JP, Utsch L, Tafuri WL, et al. (2012) NADPH Phagocyte Oxidase Knockout Mice Control  Trypanosoma cruzi  Proliferation, but Develop Circulatory Collapse and Succumb to Infection. PLoS Negl Trop Dis 6(2): e1492. doi:10.1371/journal.pntd.0001492 Editor:  Diane McMahon-Pratt, Yale School of Public Health, United States of America Received  December 13, 2010;  Accepted  December 9, 2011;  Published  February 14, 2012 Copyright:    2012 Santiago et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permitsunrestricted use, distribution, and reproduction in any medium, provided the srcinal author and source are credited. Funding:  FUNDEP was crucial for logistic suport. This work was supported by grants from Conselho Nacional de Desenvolvimento Cientı´fico e Tecnolo´gico(CNPq473597/2006-3 and 304776/2009-2), CAPES (Coordenac¸a˜o de Aperfeic¸oamento de Pessoal de Nı´vel Superior) and INCT de Processos Redox em Biomedicina-Redoxoma (CNPq/FAPESP/CAPES573530/2008-4). HCS, CZGL, JPM, LU, WLT, MJCS, AJR, FQC, MMT and LQV are CNPq fellows. RR was supported by grants fromthe National Institutes of Health (1R01AI095173-01), Howard Hughes Medical Institute and Comisio´n Sectorial de Investigacio´n Cientı´fica (CSIC)/Universidad de laRepu´blica, Uruguay. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing Interests:  The authors have declared that no competing interests exist.* E-mail: lqvieira@icb.ufmg.br .  These authors contributed equally to this work. "  These authors also contributed equally to this work.¤a Current address: Laboratory of Parasitic Diseases, National Institutes of Health, Bethesda, Maryland, United States of America¤b Current address: Department of Pathobiology, School of Veterinary Medicine, University of Pennsylvania, Philadelphia, Pennsylvania, United States of America Introduction For a long time, reactive oxygen species (ROS) were consideredthe main anti-microbial radical produced by the immune system,playing a role against bacterial, fungal and protozoa infections. After the discovery of nitric oxide (  N NO),  N NO found to play amajor role in host defense, especially against protozoan parasites. A role against  Toxoplasma   [1,2],  Plasmodium  [3] and  Leishmania   [4,5]infections was still attributed to ROS, albeit in some cases this roleremains a matter of debate [6,7,8,9].Since  N NO was found to be one of the most important IFN- c -induced anti-parasitic mechanisms, the studies about its role indifferent diseases was intensified. The advent of gene knockout(KO) technology allowed the dissection of the real extent of   N NOinvolvement in parasitic diseases.  N NO was found to be cruciallyimportant in a variety of infections [10,11], however, NOS2-deficient animals are less susceptible than  ifn- c  KO to mostmicroorganisms studied [12,13,14,15,16]. So, the search for othermechanisms of host resistance induced by IFN- c  started, and theinterest in ROS warmed up again. Trypanosoma cruzi   is an intracellular parasite associated with highmorbidity during both acute and chronic phases of infection.Resistance to this parasite is  mostly  driven by IFN- c . Thiscytokine mediates the control of parasite proliferation in tissues www.plosntds.org 1 February 2012 | Volume 6 | Issue 2 | e1492  " 8 , Cieˆncias Biolo´gicas, Universidade Federal de Ouro Preto, 8 Center for Free Radical and Biomedical Research, Universidad de la Republica, Montevideo, Uruguay ´  and blood in a NOS2-dependent way. However,  N NO may not benecessary for host resistance to  T. cruzi   infection when less virulentstrains are used [13]. In addition, previously published datasuggest that NOS2 deficient mice exhibit delayed mortality whencompared to  ifn - c  KO mice [13,14], denoting an additionaleffector mechanism involved in  T. cruzi   immune resistance.Further studies suggested IFN- c -induced p47GTPase LRG-47 asone major factor of resistance to  T. cruzi   infection along with  N NO[17,18]. Although there is convincing evidence for the effects of ROS-induced damage to  T. cruzi in vitro  [19,20], the role of thesereactive species  in vivo  has not yet been addressed. In vitro ,  T. cruzi   is readily phagocyted by macrophages andtriggers respiratory burst [19,21]. However, production of ROSalone is not sufficient to kill parasites inside these cells [20,21], andactivation by IFN- c , induction of NOS2 and production of   N NOare required [20,21,22]. In the infected macrophage,  N NO reactswith superoxide yielding peroxynitrite [21], which is a powerfuloxidant and seems to be the main effector molecule against  T. cruzi  [19]. Peroxynitrite is more efficient to kill  T. cruzi   epimastigotes  invitro  than superoxide or  N NO alone [19]. Moreover, evidence of peroxynitrite production during   in vitro  and  in vivo  infection with  T.cruzi   is available, as nitrated proteins are found both inmacrophages and in mouse and human tissues [23,24]. Indeed,it has just been reported that internalized trypomastigotes inactivated macrophages are killed by peroxynitrite-dependentmechanisms [21]. The importance of nitro-oxidative mechanismsis underscored by the finding that virulent  T. cruzi   strains, whichnaturally have high peroxiredoxin levels [25], and strainsoverexpressing peroxiredoxins [21,26] are protected from perox- ynitrite and macrophage-dependent nitro-oxidative killing (perox-iredoxins readily decompose peroxynitrite). Albeit nitration of proteins  in vivo  may be achieved independently of peroxynitrite, itis still dependent on the production of superoxide and  N NO[23,24,27] Hence, parasite damage is dependent not only on ? NO,but on both superoxide and nitric oxide.In order to investigate the contribution of ROS in resistance to T. cruzi   infection, mice deficient in the gp91  phox  (   phox   KO) subunitof NADPH oxidase, a model for chronic granulomatous disease[28], were used. These animals fail to produce ROS in endothelialcells, causing a defect in endothelium-derived relaxation of arteries[29,30], and in phagocytic cells, leading to deficient resolution of bacterial and fungal infections [28]. Although these animals werefound somewhat more susceptible to  Leishmania donovani   [5], theirsusceptibility to  L. major   is still a matter of debate [4,6]. In thepresent study,  phox   KO mice were found to succumb to infectionwith  T. cruzi  , despite adequate control of parasite replication. Theimmunological and physiological functions of ROS in such modelwere investigated. Methods Ethics statement The procedures used in this study were approved by the AnimalEthics comittee at the Universidade Federal de Minas Gerais,protocol number 031/09. All care was taken to minimize animalsuferring. Animals Inbred C57BL/6 (WT) mice (males and females, 4–6 week old)were used as controls (CEBIO, Instituto de Cieˆncias Biolo´gicas,UFMG, Belo Horizonte, MG, Brazil). Animals were kept in aconventional animal facility at controlled temperature, light/dark cycles and environmental barriers. The gp91  phox  -deficient (   phox  KO) [28] and IFN- c - deficient (  inf- c  KO) [31] mice, both inC57BL/6 background, were purchased from The JacksonLaboratories (Bar Harbor, ME, USA) and bred under specificpathogen free conditions at the Gnotobiology Laboratory,Departmento de Bioquı´mica e Imunologia, ICB, UFMG. Parasite, infection, cytokines and serum NOxmeasurements T. cruzi   (Y strain) was maintained by weekly passage in Swissmice. For in vivo experimental infections, mice were inoculatedi.p. with 1000 blood-stage trypomastigotes. The parasitemia wasevaluated by counting parasites in 5  m L of blood drawn from thetail vein [32]. Mortality of infected mice was monitored daily.Spleen cell cultures were performed as previously described [32].Briefly, splenocytes from infected mice were obtained on day 10after infection, and cultured at 5 6 10 6 cells/ml, in 24-well plates,with RPMI 1640 supplemented with 10% FCS, 2 mM  L -glutamine, 0.05 mM 2-mercapto-ethanol, 100 U/ml penicillin,and 100  m g/ml streptomycin. Cultures were maintained at 37 u Cin 5% CO 2  atmosphere. Supernatants were harvested 72 hourslater for TNF and IFN- c  measurements. Mice were bled on days0, 10 and 15 after infection and the level of serum cytokines wasevaluated. IFN- c  and TNF were measured as described previouslyusing specific ELISA kits (R&D Systems, Minneapolis, MN, USA)following the manufacturer’s protocol. Nitrate was reduced tonitrite in lipid-free serum with nitrate reductase and measured bythe Griess colorimetric reaction [33]. ELISA and immunohisto-chemistry for 3-nitrotyrosine (or nitrated proteins) was performedas previously described [24]. Quantification of parasite tissue loads and  nos2  mRNAexpression by real-time PCR or real-time RT-PCR Real-time PCR for parasite quantification was performed asdescribed previously [34] with minor modifications. Briefly, ondifferent days after infection, heart, spleen, and liver were digestedwith proteinase K, followed by a phenol-chloroform-isoamylalcohol affinity extraction. Real-time PCR using 50 ng of totalDNA was performed on an ABI PRISM 7900 sequence detection Author Summary When pathogens enter their hosts, they are fought byseveral resistance strategies, including capture by phago-cytes and the production of pathogen-toxic molecules.Nitric oxide, a free radical, has been extensively studied asone of these toxic molecules that successfully mediatesintracellular parasite killing, including  Trypanosoma cruzi  ,the protozoan parasite that causes Chagas’ disease. On theother hand, reactive oxygen species also mediate resis-tance to several pathogens, mainly bacterial. In this study,we addressed the role of reactive oxygen species in theresistance to  T. cruzi   using gene-deficient mice, a specieswhich phagocytes lack the ability to produce (  phox  2  /  2 mice). We found that phagocyte-derived reactive oxygenspecies are not critical to mediate resistance to parasite inthe knock-out animals. However,  phox  2  /  2 mice presentedhigher mortality and lower blood pressure due to infectionwith  T. cruzi   than non-deficient mice. The blood pressurewas restored to normal by an inhibitor of nitric oxidesynthesis by phagocytes. We hypothesize that superoxide(one of the oxygen reactive species) controls bloodpressure during infection with  T. cruzi,  by reacting withnitric oxide and preventing its action on blood vessels. ROS and  T. cruzi  -Mediated Circulatory Collapsewww.plosntds.org 2 February 2012 | Volume 6 | Issue 2 | e1492  system (Applied Biosystems) using SYBR Green PCR Master Mix,according to the manufacturer’s recommendations. The equiva-lence of host DNA in the samples was confirmed by measurementof genomic IL-12p40 PCR product levels in the same samples.Purified  T. cruzi   DNA (American Type Culture Collection) wassequentially diluted for curve generation in aqueous solutioncontaining equivalent amounts of DNA from uninfected mousetissues. The following primers were used for  T. cruzi   genomicDNA, TCZ, GCTCTTGCCCACACGGGTGC (forward), andCCAAGCAGCGGATAGTTCAGG (reverse); and for genomic il-12p40  , GTAGAGGTGGACTGGACTCC (forward) and CA-GATGTGAGTGGCTCAGAG (reverse).Total RNA was isolated from spleens of WT and  phox   KOinfected or non-infected mice and real-time RT-PCR wasperformed on an ABI PRISM 7900 sequence detection system(Applied Biosystems) using SYBR Green PCR Master Mix (AppliedBiosystems) after RT of 1  m g RNA using SuperScript II reversetranscriptase (Invitrogen Life Technologies). The relative level of gene expression was determined by the comparative threshold cyclemethod as described by the manufacturer, whereby data for eachsample were normalized to hypoxanthine phosphoribosyl transfer-ase and expressed as a fold change compared with uninfectedcontrols. The following primer pairs were used: for hypoxanthinephosphoribosyl transferase, GTTGGTTACAGGCCAGACTT-TGTTG (forward) and GAGGGTAGGCTGGCCTATAGGCT(reverse);  nos2 , CAGCTGGGCTGTACAAACCTT (forward) andCATTGGAAGTGAAGCGTTTCG (reverse). Hepatic and pancreatic function Serum AST and serum Amylase were measured in sera of infected and control animals using commercially available kits andfollowing manufactures instructions (KATAL, Belo Horizonte,MG, Brazil). Determination of blood pressure by tail-cuff   After exposed for 5 minutes to a white lamp, WT and  phox   KOmice were placed in a plastic restrainer. Tail blood pressure (TBP)from the animals was measured using a pneumatic cuff placed inthe base of the tail with a distally attached pulse sensor. Mice wereallowed to adjust to this procedure three times a week for twoweeks before experiments were performed. TBP values wererecorded on a tail-cuff plethysmography Model MK-2000 using Windaq software to analyze the data. At least 10 goodmeasurements for each animal were obtained per time pointand the average of selected 5 bests readings were used as TPB foran animal (n=6 animals per group). Determination of blood pressures by carotidcatheterization Mean arterial pressure (MAP) was recorded continuously inanesthetized animals by Biopac System (model MP150 A-CE,Biopac Systems, CA, USA) like described previously. In brief, micewere anesthetized by using urethane (1.2 g/kpv) administered byintraperitoneal injection at different points after infection with  T.cruzi  . The adequacy of anesthesia was verified by the absence of awithdrawal response to nociceptive stimulation of a hindpaw. Theleft common carotid artery was exposed through a 1.0- to 1.5-cmmidline incision in the ventral neck region. A catheter frompolyethylene tubing (PE 5 Intramedic, Clay Adams, BectonDickinson, Franklin Lakes, NJ, USA) was inserted approximately0.25 cm into the common carotid artery and connected topressure transducers. Supplemental doses of urethane (0.1 g/kg IV) were administered if necessary. The data were converted fromdigital to numeric form using acquisition software. Data wereprocessed by calculation of 10-min means of MAP variable.Results are expressed as means 6 SE. (measured in millimeters of mercury) of 2–6 animals per time point pooled from 3independent experiments. Treatment with iNOS inhibitors  Animals were treated with 1400SW, a NOS2 inhibitor (15 mg/Kg), i.p. on days 15 and 16 after infection with  T. cruzi  . On day 16,1400W was administered 1 h before measuring MAP. During survival experiments, 1400W (20 mg/Kg) was administered i.p.daily divided in two doses or once a day beginning on day 13 afterinfection (a time found to not affect parasite control with NOS2inhibition [35] and before MAP starts declining) for 10 days. Micetreated with vehicle were used as controls. Alternatively, animalswere treated with aminoguanidine (1% w/v) in drinking waterfrom day 13 after infection. Statistics The significance of differences between sample means wasdetermined by Student’s  t   test to compare WT to  phox   KO groupor one-way ANOVA if   inf    KO animals were being compared aswell. A mortality difference was tested using Mantel-Cox test andgroups compared using one-way ANOVA. A value of p , 0.05 wasconsidered significant. Results Mice deficient in functional NADPH oxidase control  T. cruzi  proliferation, but do not survive infection.  T. cruzi   infection isknown to induce a strong oxidative stress in the host with highproduction of ROS and NO leading to nitration of serum andtarget organs proteins [24]. Results from our lab have shown thatnot only the ROS production is deficient in gp91  phox  NADPHoxidase (   phox   KO) genetically deficient mice as described before[28], but the level of nitration of serum proteins induced by  T. cruzi  infection in  phox   KO mice is only 25% of that observed in WTcontrols (data not shown). To better investigate the role of ROS in T. cruzi   infection in vivo,  phox   KO animals were inoculated withthe Y strain of   T. cruzi  . Because this is a reticulotropic strain, it ismore appropriate to evaluate the effects of ROS deficiency inphagocytes in vivo. WT and  phox   KO mice displayed similarparasitemia, which peaked around 9 days post-infection (Fig. 1A)and was subsequently controlled. In contrast,  ifn- c  KO micepresented uncontrolled parasite counts throughout the infection.WT mice presented 60–70% of survival after day 50 of infectionand all IFN- c -deficient mice died by day 15 of infection.Surprisingly,  phox   KO animals exhibited high mortality whencompared to WT controls, starting at day 15 and reaching 100%mortality by 21 days of infection (Fig. 1B). This unexpected resultled us to investigate a possible parasite proliferation in tissues.Coherently with the parasitemia data, tissue parasitism wascontrolled by  phox   KO and WT groups at 15 days post-infectionin spleens, livers, and heart;  ifn- c  KO animals exhibited highparasite proliferation in these organs (Fig. 2).  phox   KO and WT mice presented similar immuneresponses and pathology The immune response from both WT and  phox   KO groups wasanalyzed. Both mouse strains displayed similar levels of TNF andIFN- c  in sera at 9 and 15 days post-infection (Fig. 3A). In addition,splenocytes from both groups produced expressive and equivalentlevels of IFN- c  and TNF after 9 days of infection (Fig. 3B).Importantly, tissues from both animals exhibited similar quanti- ROS and  T. cruzi  -Mediated Circulatory Collapsewww.plosntds.org 3 February 2012 | Volume 6 | Issue 2 | e1492  tative and qualitative cellular infiltration in spleens, livers andhearts (not shown). Hepatic and pancreatic proofs were slightlyincreased after infection, but similar in both groups (Table 1). NOx levels were exacerbated in  phox   KO mice withpossible involvement in hemodynamic disturbances Nitrate and nitrite (NOx) levels were evaluated in serum of infected mice.  Phox   KO mice exhibited about two fold higher levelswhen compared to WT-infected controls (Fig. 4A). Of note, NOxlevels were increased in the  phox   KO group at the same time thatmice began to die, about 15 days post-infection. The expression of  nos2  gene in the liver was measured by real-time RT-PCR andboth WT and  phox   KO mice displayed similar levels of mRNA(Fig. 4B). Because NOx levels closely relate with pressoricregulation, the blood pressure was evaluated in the tail (TBP)using the non-invasive tail-cuff method and in the carotid artery bycatheterization, at different time points (Fig. 5). When weevaluated the blood pressure in the tail, we observed that WTmice presented a good control of pressure variation as infectionprogressed, but  phox   KO mice exhibited dramatic oscillations of TBP after peak parasitemia (Fig. 5A). In order to have a moreaccurate picture of this phenomenon, we investigated the meanarterial pressure (MAP) in a central vessel, the carotid artery. Ascan be observed in figure 5B, the MAP of   phox   KO mice droppedfrom levels between 80–90 mmHg before infection to 70– 60 mmHg by the time the NOx levels starts to increase in theserum, at day 8 post-infection, and further down as infectionprogressed. WT group displayed a good control of MAP till day 12post-infection, but a drop in the blood pressure at day 14 to a levelsimilar to that observed in the  phox   KO group occurred. WhileWT mice restored blood pressure to normal levels,  phox   KOcounterparts were unable to restore physiological MAP (Fig. 5B).In order to verify the role of   N NO produced by NOS2 in the dropof blood pressure and in mortality,  phox   KO mice were treated with1400W, a selective inhibitor of NOS2. Injections with 1400W wereable to inhibit  N NO levels in the blood (data not shown) and torestore blood pressure levels (Fig. 5C). However, animals treateddaily (not shown) or every 12 hours with 1400W displayed similarmortality rates to that of control mice (Fig. 5D). We treated theanimalswith a lessselectiveNOS2 inhibitor (aminoguanidine) inthedrinking water (1% w/v) from day 13 of infection and no effect wasobserved on the mortality of   phox   KO infected mice (data notshown). These treatments did not impact the control of parasiteproliferation in either WT or  phox   KO animals, nor changed theoutcome of the disease in WT mice (data not shown). Figure 1. NADPH oxidase deficient-mice control parasitemia,but succumb to infection with  T. cruzi  .  WT,  phox   KO and  inf- c  KOmice were infected with 1000 blood-born trypomastigotes of Y strain of  T. cruzi  . Parasitemia (A) and mortality (B) were accessed daily. (A) Pointsrepresent mean 6 SE of 5 animals per group of one from three differentexperiments performed with similar results. Asterisks represent P , 0.05by Student’s  t   test. (B) Mortality curve is pooled from three differentexperiments and P , 0.05 among all groups in the graph.doi:10.1371/journal.pntd.0001492.g001 Figure 2.  phox   KO mice control parasite proliferation in target organs.  WT,  phox   KO and  inf- c  KO mice infected with  T. cruzi   were sacrificedon days 10 and 15 post-infection and tissue parasitism in spleen, heart and liver evaluated by real-time PCR as described in material and methods.Bars represent mean 6 SE of four animals per group. Arrows indicate P , 0.05 between WT and  phox   KO animals. The parasitism of   ifn- c  KO group isstatistically different from WT and  phox   groups in all organs and times analyzed, except for the heart at day 10 post-infection.doi:10.1371/journal.pntd.0001492.g002ROS and  T. cruzi  -Mediated Circulatory Collapsewww.plosntds.org 4 February 2012 | Volume 6 | Issue 2 | e1492  Discussion The involvement of ROS in host resistance against infectiousdiseases is well known [36], especially for bacterial and fungalinfections. However, while some reports suggest the involvementof ROS in protozoa infections [1,2,3,4,5], others fail to find amajor effect of these radicals in control of infections with  L. major  [6],  T. gondii   [37] and  Plasmodium  [9]. Importantly, chronicgranulomatous disease patients are known to suffer from severebacterial and fungal infections [38], but rarely from severeprotozoa infections [39]. Interestingly, data from our laboratorysuggests that infection with  T. cruzi   can induce a strong oxidativestate in the host with production of   N NO, ROS and superoxidecausing nitration of proteins in serum and target tissue [24] (anddata not shown). ROS is known to be produced by macrophagesfollowing in vitro  T. cruzi   infection and to be one of the majoroxidative agents on  T. cruzi  , reducing its viability dramatically[19,21,40]. In this study, we investigated the role of ROS on  T.cruzi   infection in vivo and surprisingly we found an importantphysiological effect of ROS, unrelated to the control of parasite.In the present study, we found that animals deficient in gp91  phox  subunit of NADPH oxidase, a mouse model for chronicgranulomatous disease [28], were able to efficiently controlproliferation of Y strain of   T. cruzi  . Hence, parasitemia andparasite loads in spleen, liver and heart were similar in  phox   KOand WT mice. This result could suggest that ROS play a minorrole in restriction of protozoal infection during   in vivo  infections. Onthe other hand, when carefully examined  in vitro , the effects of ROSon parasite control can be appreciated, especially the effect of peroxynitrite. For example, macrophage-derived ROS and perox- ynitrite were found to cause major oxidative burden on  T. cruzi  ,reducing its viability dramatically [19,21,40]. Indeed, the virulenceof different parasite strains can be predicted by the expression of some enzymes involved in the parasite anti-oxidant network such asTcTS, TXN, TcMPX, TcAPX and FeSOD-A [25]. The fact thatmacrophage-derived ROS were found to have little involvement inparasite control in  phox   KO mice may be related to othermechanisms of resistance operating   in vivo  such as compensatory N NO production, p47GTPases expression [17,18], CD8 T cellsinvolvement [41] and alternative cellular sources of superoxide andperoxynitrite. Regarding this last point, we should indicate thatnormally, in activated macrophages, phagocyte-derived superoxidereacts with  N NO to yield peroxynitrite [21]; thus, in wild typeanimals superoxide from inflammatory cells plays a key rolein  N NO-dependent cytotoxicity towards  T. cruzi   [20]. However, in the  phox  KO mice, the lack of macrophage-derived superoxide, increases the N NO levels diffusing into the parasite, which in turn, inhibit theparasite mitochondrial respiration and secondarily enhance mito-chondrial superoxide formation [25]. Overall, these processes leadto intramitochondrial formation of peroxynitrite and  T. cruzi  cytoxicity. Indeed, the exceeding available  N NO in  phox   KO couldbe responsible for parasite control, including the formation of peroxynitrite in parasite mitochondria [20] or by NOX4, recentlyfound in macrophages[42]. Higher levels of   N NO found in sera from  phox   KO mice could not be attributed to higher expression of NOS2. This could be explained simply by the fact that  N NO is notreacting with superoxide to yield peroxinitrite in  phox   KO. Anotherpossibility is raised by the fact that superoxide facilitates uncoupling of NOS and oxidation of tetrahidrobiopterin, therefore in itsabsence NOS would be more active and produce more  N NO [43].In addition to their anti-infection role, ROS are involved inenhancing TLR signaling. Recently, it was demonstrated that ROSproduction is activated by TLR signaling through MyD88 and via thep38 MAPKinase cascade [44]. After their production is activated byTLR-dependent or independent pathways, ROS are able to enhanceTLR4 expression on the cell surface [45] and to strength NF- k Bactivation [46]. The resistance to infection with  T. cruzi   is known todepend on appropriate MyD88 signaling [32] after stimulation of TLR2 and TLR9 [47], and TLR4 [48]. Although this function of  Figure 3. WT and  phox   KO mice producesimilar levels of IFN- c  and TNF.  (A) WT and  phox   KO animals infected with  T. cruzi   were bled at days10 and 15 post-infection for cytokine measurements. (B) Infected mice were sacrificed at 10 days post-infection and spleen cells isolated and culturedfor 72 hours, when supernatants were harvested. IFN- c  and TNF were measured by ELISA as described in material and methods. Bars represent mean 6  SE of at least 4 animals per group. Experiment was repeated once with similar results.doi:10.1371/journal.pntd.0001492.g003 Table 1.  Serum AST and amylase in WT and  phox   KO miceinfected with  T. cruzi. Days of  infection: 0 8 12 15  AST a WT  60.7 6 10.6 219.9 6 39.1 139.7 6 34.0 119.9 6 78.5 Phox   KO  73.0 6 5.0 207.6 6 35.9 225.5 6 22.5 136.3 6 87.0 Amylase b WT  259.2 6 83.4 506.2 6 85.1 506.9 6 73.5 507.4 6 91.8 Phox   KO  246.4 6 113.3 520.6 6 161.9 526.1 6 47.9 486.6 6 146.2Values from AST and amylase are combined from 3 independent experimentswith n=3 for each independent experiment. a AST values are expressed in IU/L; b Amylase values are expressed in U/L.doi:10.1371/journal.pntd.0001492.t001 ROS and  T. cruzi  -Mediated Circulatory Collapsewww.plosntds.org 5 February 2012 | Volume 6 | Issue 2 | e1492
Related Documents
View more...
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks