Home & Garden

14 pages
24 views

Characterization of the heat-shock protein 60 chaperonin from Onchocerca volvulus☆

of 14
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Share
Description
Characterization of the heat-shock protein 60 chaperonin from Onchocerca volvulus☆
Transcript
  Molecular and Biochemical Parasitology 107 (2000) 155–168 Characterization of the heat-shock protein 60 chaperoninfrom  Onchocerca   ol   ulus  Yang Wu  a, *, Gillian Egerton  a , Amanda Ball  a , Robert M. Tanguay  b ,Albert E. Bianco  a a Di   ision of Molecular Biology and Immunology ,  Li   erpool School of Tropical Medicine ,  Li   erpool L 3 5  QA ,  UK  b Laboratory of Cell and De  elopmental Genetics ,  Department of Medicine ,  Uni   ersite La  al  ,  Ste - Foy ,  Quebec ,  Canada G  1 K   7  P 4  Received 28 September 1999; received in revised form 25 November 1999; accepted 25 November 1999 Abstract Chaperonin 60  (  cpn 60)   belongs to the group of ubiquitous molecular chaperones that comprise the heat shockproteins, nucleoplasmins and chaperonins. Antibodies to recombinant CPN60 from humans was used to screen acDNA library of   Onchocerca   ol   ulus  and antigen-positive clones were selected. Sequencing of the DNA insertsconfirmed their identity as  cpn 60   transcripts. These are distinct from a  cpn 60   sequence recorded previously from  O .  ol   ulus  (GenBank accession number Y09416) that appears to be of endobacterial srcin, rather than derived from theparasite itself. The full-length sequence of the cDNA (designated Ov- cpn 60)   codes for a protein of 64.3kDa (598amino acid residues) and shares significant identity with homologous gene products from  Caenorhabditis elegans (72%)  , humans (69%), yeast (53%) and  Escherichia coli   (50%). The endobacterial and parasite sequences are 41%conserved. Ov-CPN60 migrates with an apparent molecular mass of 65kDa on SDS-PAGE and is present in alllife-cycle stages, as determined by immunoblotting with rabbit antibodies raised against the recombinant protein.Immunogold electron microscopy identified the protein within mitochondria, as expected, but also in extra-mitochon-drial sites, including inclusion bodies of the glandular oesophagus (in infective larvae), the uterine wall, cytosol of developing spermatids, and the hypodermis and cuticle. Endobacteria were also labelled, indicating cross-reactivitybetween CPN60 from the parasite and its intracellular symbiont. In human infections, serum antibodies to Ov-CPN60were present in only 11% of cases from Ecuador, but in 81–89% of subjects in three separate foci from West Africa.There was no relationship between antibody levels and age, sex, or infection intensity, and no consistent associationbetween the serological response and immune status. An evaluation of antibody specificities in individual serarevealed a mixture of parasite-specific and host crossreactive anti-CPN60 antibodies, the ratio of which variedamongst geographic areas. It is concluded that antibody responses to Ov-CPN60 are unlikely to contribute either tohost protection or pathology in onchocerciasis. © 2000 Elsevier Science B.V. All rights reserved. www.elsevier.com / locate / parasitology Abbre  iations :   hsp, heat shock protein; kb, kilobase; kDa, kilodalton; L3, third-stage larva; mf, microfilariae; nt, nucleotide; PCR,polymerase chain reaction.  Note :   Nucleotide sequence data reported in this paper have been submitted to the GenBank™ data base with the accessionnumber AF121264* Corresponding author. Tel.:  + 44-151-7089393; fax:  + 44-151-7089007. E  - mail address :   ywu@liverpool.ac.uk (Y. Wu)0166-6851 / 00 / $ - see front matter © 2000 Elsevier Science B.V. All rights reserved.PII: S0166-6851(99)00227-3  Y  .  Wu et al  .  /   Molecular and Biochemical Parasitology  107 (2000) 155–168  156 Keywords :   Onchocerca   ol   ulus ; Heat shock protein 60; Chaperonin 60; Mitochondria; Extra-mitochondrial localization; Serologicalresponse 1. Introduction Chaperonin 60  (  cpn 60)   belongs to the group of ubiquitous molecular chaperones that comprisethe heat shock proteins (hsp), nucleoplasmins andchaperonins [1–3]. CPN60 falls within the ‘classi-cal’ chaperonin family and is a highly conservedmolecule that is represented in a diverse range of organisms from bacteria (e.g. the GroEL moleculeof   Escherichia coli   [4]) to mammals (e.g. the so-called P1 protein from humans [5]). Classicalchaperonins localize mainly to the cytosol in bac-teria, the chloroplasts in plants and the mitochon-dria in animals [3]. They form multimericstructures comprising a stacked pair of rings con-taining seven subunits each. A smaller subunit(CPN10, or GroES in bacteria) forms a secondring structure that acts as a lid on the doubletorus of CPN60 molecules [6]. CPN60 bindsnewly synthesised polypeptides in non-nativeconfigurations through exposed hydrophobicplanes [7]. Unfolding, refolding and release of native polypeptide follows conformationalchanges directed by the binding and hydrolysis of ATP within the CPN60 / 10 complex. By thismeans, CPN60 plays a fundamental role in thepost-translational folding, assembly and targetingof proteins within prokaryotic and eukaryoticcells [7].Some chaperonins are subject to inducible ex-pression following heat-shock (hence HSP60),while others are constitutively expressed [8]. Thishas lead to an interest in the expression of HSP / CPN molecules in relation to the biology of para-sitism, from the dual perspectives of up-regulatedexpression by parasites entering a homothermicenvironment, and overexpression by host cellsresponding to the stress of infection [9,10]. Inmicrobial diseases, bacterial HSP60 may be rela-tively immunogenic, driving both a heightenedhumoral and cellular response [11–14]. Auto-im-mune responses to HSP60, potentially triggeredby infection, have been associated with the patho-genesis of a range of conditions — includingrheumatoid arthritis, atherosclerosis, diabetesmellitus and gastro-duodenal disease [14–18].Because of the fundamental importance of CPN60 in protein biosynthesis, and its potentialsignificance to the host immune response, wewished to isolate and examine the homologousmolecule from the filarial nematode  Onchocerca  ol   ulus , the causative agent of onchocerciasis (or‘river blindness’). Relatively little attention hasbeen paid to chaperonins of metazoan parasites.Here we report the sequence and characteristics of Ov-CPN60, its temporal and spatial expression,and its immunogenicity in cases of humanonchocerciasis. 2. Materials and methods 2  . 1 .  Parasite material  Adult worms and microfilariae of   O .   ol   ulus were recovered from nodules excised from pa-tients attending a clinic at the Medical ResearchLaboratories in Kumba, Cameroon (as part of aclinical management programme). Microfilariaewere purified on discontinuous Percoll gradients,as described [19]. Blackflies  (  Simulium damnosums . l  .  )   infected with  O .   ol   ulus  L3 larvae were ob-tained from the Medical Research laboratory atKumba, Cameroon (courtesy of Drs S. Lustigmanand P. Enyong). Cryopreserved infective larvaewere supplied by Dr Lustigman (New York BloodCentre), operating an Onchocerciasis ResourcesProject on behalf of the Edna McConnell ClarkFoundation (New York, USA).The related filaria,  Acanthocheilonema   iteae was obtained from a laboratory-adapted cyclemaintained in Mongolian jirds  (  Meriones unguicu - latus  )   and argasid ticks  (  Ornithodorus tar - tako  skyi   )  . L3 larvae were obtained from ticksinfected at least 28 days previously. Adult wormswere recovered from the subcutaneous tissues of  jirds 60 days or greater following infection.  Y  .  Wu et al  .  /   Molecular and Biochemical Parasitology  107 (2000) 155–168   157 2  . 2  .  Immunoscreening of O .   ol   ulus cDNA A cDNA library constructed in   Uni-ZAP XRwith mRNA derived from infective L3 larvae of  O .   ol   ulus  was kindly provided by Dr SteveWilliams (Smith College, Northampton, MA).Details of library construction are reported by Luand colleagues [20]. Bacteriophage plaque formingunits (5 × 10 5 ) were plated on  Escherichia coli  strain XL-Blue and induced to express   -galac-tosidase fusion proteins by growth at 42°C in thepresence of isopropyl  p - D -thiogalactopyranoside(IPTG). Impressions of the plaques were trans-ferred to nitrocellulose filters and screened withrabbit antibodies (diluted 1:3000) raised againsthuman CPN60 by plaque immunoassay [21]. Im-munopositive clones were selected and subjectedto three rounds of screening and reselection. 2  . 3  .  Production of recombinant protein and monospecific antibodies Ov- cpn 60   cDNA was recovered from   Uni-ZAP XR by excision of the Bluescript phagemidand amplification of the insert by PCR usingforward (5   GCATATGGCACGACTTGTTTC3  ) and reverse (5   GGATCCTTTATGGGAACC-GATTA 3  ) primers corresponding with the endsof the open reading frame sequence. Restrictionenzyme target sequences ( Nde l and  Bam H1, re-spectively) were incorporated into the primers toaid directional sub-cloning. PCR products werecloned into the TA vector, pCR2.1-TOPO (Invit-rogen, Leek, The Netherlands) and excised by Nde l × Bam H1 digestion. The modified insert wasligated into the expression vector, pJC40 [22],transformed into  E  .  coli   DE3 cells, induced withIPTG and expressed as a fusion with a polyhis-tidine tag. Recombinant protein was purified byaffinity chromatography on a Ni column(Probond resin, Invitrogen) according to the man-ufacturer’s instructions.Recombinant human CPN60 (Hs-CPN60) [23]in pET3a [24] was expressed in DE3 cells afterIPTG induction. Antigen was purified by prepara-tive SDS-PAGE and electro-elution.Antibodies to the recombinant CPN60 proteinswere produced in rabbits by immunization with100   g antigen emulsified in Freunds completeadjuvant (for the first inoculation) or Freundsincomplete adjuvant (subsequent inoculations).Antigens were administered by subcutaneous in- jection on each of three occasions, at intervals of 3 weeks. Rabbits were bled 8 days after boosting.Specificity of the antibodies was tested by probingimmunoblots of recombinant proteins and para-site extracts. 2  . 4  .  DNA sequencing  Ov- cpn 60   in pCR2.1-TOPO was sequenced byprimer walking, using universal M13 primers andsequence-specific primers complementary to re-gions of the insert. DeltaTaq cycle sequencing wasperformed in conjunction with an ABI Technol-ogy 373 sequencer. Some manual sequencing wasalso employed, using the double strandeddideoxynucleotide method [25] and Sequenase 2.0(Amersham), according to the manufacturer’sprotocol. 2  . 5  .  Gel electrophoresis and immunoblotting  Proteins were extracted from parasites by boil-ing for 5 min in electrophoresis sample buffer (3%(w / v) SDS, 62 mM Tris–HCl pH 6.8, 15% (v / v)glycerol) containing 5% 2-mercaptoethanol. Insol-uble material was removed by centrifugation for 5min at 16000 ×  g  . Extracts were fractionated on12.5% polyacrymide gels using the Tris–glycine– SDS system [26] with molecular mass markers( M  r : 94 kDa, phosphorylase b; 67 kDa, bovineserum albumin; 43 kDa, ovalbumin; 30 kDa, car-bonic anhydrase; 20 kDa, soybean trypsin in-hibitor; 14 kDa, a-lactalbumin). Separatedproteins were electrophoretically transferred tonitrocellulose and the membranes were blockedby overnight incubation in 5% foetal calf serum inTris / saline / Tween (TST: 0.01 M Tris pH 8.5 / 0.15M sodium chloride  / 0.1% tween 20). Blots wereprobed with rabbit anti CPN60 antibodies at1:3000 dilution in TST. Goat anti-rabbit IgG(H + L) horseradish peroxidase conjugate(Nordic, 1:2000) was used to localize antibody-antigen complexes. The blot was developed using0.05% (w / v) 3,3  diaminobenzidine tetrahydrochlo-ride solution.  Y  .  Wu et al  .  /   Molecular and Biochemical Parasitology  107 (2000) 155–168  158 2  . 6  .  Immunogold electromicroscopy Adult worms and microfilariae in nodules, anddeveloping larvae in blackflies, were fixed in 2%paraformaldehyde / 0.5% glutaraldehyde in 0.075M sodium cacodylate buffer and embedded forimmunoelectron microscopy, as described [27].Sections (90 nm) mounted on formvar coatednickel grids were reacted with anti Ov-CPN60rabbit antisera serially diluted from 1:200 to1:1000 in 1% BSA / 0.01% Tween 20 in PBS. Con-trol sections were probed with normal rabbitserum, antisera to unrelated antigens and theincubation buffer alone. Antibody-antigen com-plexes were revealed by reaction with goat anti-rabbit IgG conjugated to 10, 15 or 20 nm gold(Bio Clin Immunogold Reagents). Sections werecounterstained in 2% aqueous uranyl acetatesolution. 2  . 7  .  Heat shock treatment ,  metabolic labelling and immunoprecipitationA .   iteae  infective larvae and adult worms wereused in heat shock experiments. Parasites recov-ered freshly from host tissues were placed inRPMI 1640 medium (Gibco) and exposed to tem-peratures of 37, 42 or 44°C for intervals of 10–30min. Temperature was subsequently adjusted topre-recovery levels in the host (27°C for infectivelarvae and 37°C for adult worms) and cultureswere maintained for a further 6 h. [ 35 S]-methion-ine was added to the medium (100   Ci / ml) formetabolic labelling of proteins synthesised duringheat shock. Parasites maintained at a constanttemperature were included as controls.Labelled parasites for use in immunoprecipita-tion reactions were solubilized by sonication inlysis buffer (50mM Tris–HCl pH 7.4  / lSOmMNaCl / 0.5% NP-40 / 1.5 mM MgCl 2 ) Extracts werecentrifugation at 14000 ×  g   for 20 min at 4°C andthe pellets discarded. Parasite lysates were pre-cleared of non-specific reactants by the additionof pre-immune rabbit serum and Protein A Sep-harose followed by centrifugation at 14000 ×  g  for 10 min. Supernatant fluid was reacted with 3  l rabbit anti Ov-CPN60 serum overnight at 4°C.Immune complexes were captured by incubationwith Protein A–Sepharose for 1 h at room tem-perature. The bounded Protein A–Sepharose waswashed three times with TST buffer and dissoci-ated by heating to 100°C for 5 min in elec-trophoresis sample buffer. Samples were subjectedto SDS-PAGE. Captured antigen was quantifiedby autoradiography and densitometry. 2  . 8  .  Human infection sera Sera were obtained from patients presenting fornodulectomy at a clinic in Hohoe, Ghana andfrom the Edna McConnell Clark Foundation(EMCF) onchocerciasis serum bank, maintainedat the Swiss Tropical Institute, Basel. All 39 of theGhanian sera were derived from individuals withparasitological signs of infection (palpable nod-ules, microfilariaepositive skin snips). Samplesfrom the EMCF serum bank originated fromendemic regions within Ecuador ( n = 43),Cameroon ( n = 182) and Togo ( n = 66). In eachof these locations, sera were derived from individ-uals showing parasitological signs of current in-fection (classified as ‘infected’), or from personsthat had neither palpable nodules or positive skinsnips (classified as ‘putatively immune’). EMCFcriteria for defining putative immunity include aminimum of 20 years residency in the endemicarea and no history of recent treatment (past 3years). Sera from unexposed individuals were ob-tained from UK volunteers. 2  . 9  .  Enzyme - linked immunosorbent assays (  ELISA  )  Human sera were analysed by ELISA for IgGantibodies to CPN60 antigens, using modifica-tions to the procedure, as described [28].Maxisorp plates (Nalge Nunc International) werecoated overnight with purlfied Ov-CPN60 or Hs-CPN60 at a concentration of 1   g / ml in 0.05 Mcarbonate buffer (pH 9.6). Wells were blocked byovernight incubation with 20% (v / v) soya milk inTST. Sera were diluted 1:200 in 20% soya / TSTand applied to duplicate plates for 2 h at roomtemperature. The wells were washed in TST, andgoat anti-human IgG (H + L) horse radish perox-idase conjugate (Nordic) was added at 1:3000  Y  .  Wu et al  .  /   Molecular and Biochemical Parasitology  107 (2000) 155–168   159 dilution in 20% soya / TST for 1 h at room temper-ature. Plates were washed and the assay wasdeveloped using 0.02% 2,2  -azino-bis(2-ethylben-zthiazoline-6-sulfonic acid) (ABTS) (Sigma). Theabsorbance at 405 nm was read on a DynatechMR 5000 plate reader. 3. Results and discussion 3  . 1 .  Cloning of an O .   ol   ulus cpn 60   homologueand sequence analysis Monospecific rabbit antibodies to Hs-CPN60were reacted with an immunoblot of   O .   ol   ulus adult worm extract to determine whether cross-re-acting specificities were present that could be usedto isolate the parasite homologue by immunos-creening of cDNA. As expected, the antibodiesreacted strongly with a polypeptide of 65 kDa(Fig. 1, lane 1). They also cross-reacted with asecond component of approximately 18 kDa.Clones (5 × 10 5 ) from an  O .   ol   ulus  L3 cDNAlibrary in   Uni-ZAP XR were screened by plaqueimmunoassay with the anti Hs-CPN60 antibodies.Three clones were picked on the first round of screening. These were plaque purified, the pBluse-cript phagemids were excised and the inserts werePCR-amplified using T3 and T7 primers. Each of them generated a product of approximately 2 kb.Sequencing confirmed their identity as cpn-liketranscripts. One of them was selected for sub-cloning and expression.The cDNA selected was 2142 nt long (GenBankaccession number AF121264). This has a transla-tion initiation codon 47 nt from the 5   end. Thereis a stop codon (TGA) at nt 1842-4, followed byeight in-frame stops through the 245 nt 3   un-translated region (UTR). The open reading frame(ORF) is 1797 nt long and codes for 598 aminoacid residues. The sequence is 57% A-T within theORF, rising to 66% in the 5   and 3   UTRs. Thededuced amino acid sequence of the cDNA has apredicted molecular mass of 64.3 kDa. Thisclosely accords with the size of the major polypep-tide recognised by anti Hs-CPN60 antibodies inparasite extracts (Fig. 1, lane 1) and falls withinthe expected size range for the product of ancpn60 / hsp60 gene [4,5,8]. The sequence containsthe canonical chaperonin 60 signature(AAVEEGIVPGGG [29]) between amino acidresidues 420 and 431. BLAST X analysis revealeda high degree of sequence similarity with cpn / hsp60 genes from other organisms, including hu-man cpn60 (high score, 1790; probability:5 × 10 − 235 ) against which the screening antibodieswere made. The sequence did not show similarityto cytosolic chaperonins of the CCT family, repre-sented by TCP-1 from mouse and the multiplesubunits of CCT from  Caenorhabditis elegans [30,31]. Accordingly, we conclude that the cDNAis derived from an authentic  O .   ol   ulus cpn 60  gene. Because it appears to most closely to resem-ble a chaperonin and its expression is not heat-in-ducible (see below), it has been designatedOv- cpn 60  , in accordance with guidelines of theFilarial Unified Nomenclature Kommittee(FUNK [32]).Searching of the NCBI database revealed asecond  cpn 60   sequence (accession numberY09416) that has been cloned from  O .   ol   ulus (Gallin et al., unpublished). This also contains thechaperonin 60 signature, but exhibits a relativelylow overall level of sequence similarity with Ov- cpn 60   (44% at the DNA level and 41% at theamino acid level). To examine the relationship Fig. 1. Immunoblot of   O .   ol   ulus  life-cycle stages probed withrabbit antisera to recombinant Hs-CPN60 (lane 1) and Ov-CPN60 (lanes 2–5). Samples from left to right are: 1, adultfemale; 2, microfilariae; 3, infective L3 larvae; 4, adult female;5, adult male.
Related Documents
View more...
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks