Nature & Wildlife

12 pages
6 views

A Key Role for Transmembrane Prolines In Calcitonin Receptor-Like Receptor Agonist Binding and Signalling: Implications for Family B G-Protein-Coupled Receptors

of 12
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Share
Description
A Key Role for Transmembrane Prolines In Calcitonin Receptor-Like Receptor Agonist Binding and Signalling: Implications for Family B G-Protein-Coupled Receptors
Transcript
   A Key Role for Transmembrane Prolines in CalcitoninReceptor-Like Receptor Agonist Binding and Signalling:Implications for Family B G-Protein-Coupled Receptors  Alex C. Conner, Debbie L. Hay, John Simms, Stephen G. Howitt, Marcus Schindler,David M. Smith, Mark Wheatley, and David R. Poyner School of Life and Health Sciences, Aston University, Birmingham, United Kingdom (A.C.C., D.L.H., S.G.H.); Department of Metabolic Medicine, Imperial College School of Medicine, Hammersmith Hospital, London, United Kingdom (D.L.H.); School of Biosciences, University of Birmingham, Birmingham, United Kingdom (J.S., M.W.); Metabolic Research, Boehringer IngelheimPharma KG, Biberach, Germany (M.S.); and AstraZeneca, CVGI, Macclesfield, Cheshire, United Kingdom (D.M.S.) Received November 7, 2003; accepted September 28, 2004 This article is available online at http://molpharm.aspetjournals.org  ABSTRACT Calcitonin receptor like-receptor is a family B G-protein cou-pled receptor (GPCR). It requires receptor activity modifyingprotein (RAMP) 1 to give a calcitonin gene-related peptide(CGRP) receptor. Little is known of how members of thisreceptor family function. Proline residues often form impor-tant kinks in   -helices. Therefore, all proline residues withinthe transmembrane helices of the receptor (Pro241, Pro244in helix 4, Pro275 in helix 5, Pro321 and Pro331 in helix 6)were mutated to alanine. Pro241, Pro275, and Pro321 arehighly conserved throughout all family B GPCRs. The bindingof CGRP and its ability to stimulate cAMP production wereinvestigated in mutant and wild-type receptors after transienttransfection into COS-7 cells with RAMP1. The P321A mu-tation significantly decreased the pEC 50  for CGRP and re-duced its affinity but did not change cell-surface expression. Antagonist binding [CGRP 8–37  and 1-piperidinecarboxam-ide,  N  -[2-[[5amino-1-[[4-(4-pyridinyl)-1-piperazinyl]carbon-yl]pentyl]amino]-1-[(3,5-dibromo-4-hydroxyphenyl)methyl]-2-oxoethyl]-4-(1,4-dihydro-2-oxo-3(2 H  )-quinazolinyl)(BIBN4096BS)] was little altered by the mutation. Ad-renomedullin-mediated signaling was disrupted when P321A was coexpressed with RAMP1, RAMP2, or RAMP3. TheP331A mutant produced a moderate reduction in CGRPbinding and receptor activation. Mutation of the other resi-dues had no effect on receptor function. Thus, Pro321 andPro331 are required for agonist binding and receptor activa-tion. Modeling suggested that Pro321 induces a bend in helix6, bringing its C terminus near that of helix 3, as seen in manyfamily A GPCRs. This is abolished in P321A. P321A-I325P,predicted to restore this conformation, showed wild-typeactivation. Modeling can also rationalize the effects of trans-membrane proline mutants previously reported for anotherfamily B GPCR, the VPAC 1  receptor. The calcitonin receptor-like receptor (CL) is a seven-trans-membrane helix protein that is strongly homologous with thecalcitonin receptor, a member of the family B of G-protein-coupled receptors (GPCRs). This family includes receptors forlarger peptides such as glucagon, vasoactive intestinal pep-tide, and pituitary adenylate cyclase-activating peptide. CLwill not bind any known endogenous ligand unless it is asso-ciated with a single transmembrane (TM) receptor activitymodifying protein (RAMP); it is currently the only GPCRknown to display this behavior. With RAMP1, CL acts as areceptor for calcitonin gene-related peptide (CGRP) but whenassociated with either of the related proteins RAMP 2 orRAMP3, CL forms receptors for adrenomedullin (AM), an-other peptide member of the CGRP/calcitonin family(McLatchie et al., 1998). To obtain cAMP-mediated signaling,another accessory protein, receptor component protein, alsoseems to be required (Evans et al., 2000). In view of thisunique arrangement, the mechanism of ligand binding andactivation of CL is of considerable interest.The family A GPCRs include receptors for rhodopsin, cat- This work was supported by a grant from the Wellcome Trust (to D.R.P.,M.W., and D.M.S.). D.L.H. was supported by a Medical Research Councilstudentship. A.C.C. and D.L.H. contributed equally to this study.  ABBREVIATIONS:  CL, calcitonin receptor-like receptor; GPCR, G-protein-coupled receptors; TM, transmembrane ; RAMP, receptor activitymodifying protein; CGRP, calcitonin gene-related peptide; AM, adrenomedullin; HA, hemagglutinin; BSA, bovine serum albumin; ELISA,enzyme-linked immunosorbent assay; WT, wild-type; DPPC, di-palmitoyl-phosphatidylcholine; BIBN4096BS, 1-piperidinecarboxamide, N  -[2-[[5amino-1-[[4-(4-pyridinyl)-1-piperazinyl]carbonyl]pentyl]amino]-1-[(3,5-dibromo-4-hydroxyphenyl)methyl]-2-oxoethyl]-4-(1,4-dihydro-2-oxo-3(2H)-quinazolinyl); GppNHp, guanyl-5  -yl-imidodiphosphate; RMSD, root-mean-square deviation. 0026-895X/05/6701-20–31$20.00M OLECULAR  P HARMACOLOGY   Vol. 67, No. 1Copyright © 2005 The American Society for Pharmacology and Experimental Therapeutics 3085/1187723  Mol Pharmacol  67:20–31, 2005  Printed in U.S.A. 20   a  t  A S P E T  J   o ur n a l   s  on J   a n u a r  y1  8  ,2  0 1  7 m ol   ph  a r m . a  s  p e  t   j   o ur n a l   s  . or  gD o wnl   o a  d  e  d f  r  om   echolamines, and some peptides and constitutes the largestand most studied family. In many cases, the binding domainsof their ligands have been mapped (Gether, 2000; Gershen-gorn and Osman, 2001; Lu et al., 2002; Wesley et al., 2002).There are strongly conserved regions that have known func-tion [e.g., the DRY motif involved in signaling (Gershengornand Osman, 2001)]. Elucidation of the crystal structure of rhodopsin will help to refine the current models (Palczewskiet al., 2000). The family B GPCRs have been much lessstudied. The conserved regions that are found in family A arenot found in family B, so the extent to which informationderived from the crystal structure of rhodopsin can be used inunderstanding the family B GPCRs is unclear (Donnelly,1997). There have been some studies of the role and structureof the N termini of family B receptors (e.g., parathyroidhormone, cortisol releasing factor), but there is little corre-sponding information on the TMs (Pellegrini et al., 1998;Wille et al., 1999). Because CL differs from most other familyB receptors in its interaction with RAMPs, it may showadditional structural adaptations. Indeed, the functional re-ceptors formed from the CL protein and RAMPs are effec-tively receptors with eight transmembrane regions.The identity of the residues within CL that are importantfor RAMP interaction, ligand binding, G-protein coupling,and receptor activation are largely unknown. The only studyof specific regions of CL has been of the N terminus (Gujer etal., 2001; Kamitani and Sakata, 2001; Koller et al., 2002),where two ligand interaction sites have been defined, similarto those found in other members of this family (Gether,2000). By analogy with other B-family GPCRS, ligand inter-action sites in the extracellular loop regions and the trans-membrane domains could also be expected (Gardella andJuppner, 2001; Waelbroeck et al., 2002).Proline may induce a kink in an  -helix. The degree of kinkis dependent on the local environment. Proline-induced kinkscan disrupt helices and influence their packing and organi-zation. The influence of proline residues has been shown inmany mutational and structural studies (Cordes et al., 2002).In family A, conserved proline residues in TMs 5, 6, and 7 arecrucial for receptor function and may define molecular hingesallowing appropriate movement of the transmembrane re-gions above and below the proline (Hulme et al., 1999;Gether, 2000). Indeed, the conservation of these prolines is sopronounced that they are among the reference residues usedfor comparing GPCR structure/function within family A GPCRs (Ballesteros and Weinstein, 1995). Family B GPCRsalso possess conserved prolines, but these are different fromthe signature prolines conserved between members of family A. In CL, these are Pro241 (TM 4), Pro275 (TM 5), andPro321 (TM 6). There are two additional TM prolines in CL,Pro244 (TM 4) and Pro331 (TM 6), but these are restricted toCL and the calcitonin receptor (Fig. 1). The study presentedhere has analyzed the function of all five TM proline residuesof CL using site-directed alanine substitution. Our data showthat Pro321 and Pro331 in TM6 are required for high affinityagonist binding and receptor activation. It is possible that, atleast for this family B GPCR, TM6 has a role in receptoractivation broadly similar to that seen in many family A GPCRs. Materials and Methods Materials.  Human   CGRP and human   CGRP 8–37  were fromCalbiochem (Beeston, Nottingham, UK) or Neosystems (Stras-bourg, France). Rat AM was obtained from Bachem (St. Helens,Merseyside, UK). All peptides were dissolved in distilled waterand stored as aliquots at   20°C or   70°C (AM) in nonstick mi-crocentrifuge tubes (Thermo Life Sciences, Basingstoke, UK). Un- Fig. 1.  Amino acid sequence of human CL showing thepositions of the TM proline residues. P241A, P244A,and P331A are conserved within the calcitonin receptorfamily. P275A is almost completely conserved through-out the family B GPCRs, and P321A is also stronglyconserved. The first 22 amino acids of CL are predictedto form a signal sequence (shown by the line); followingthe system used by Koller et al., (2002), the amino acidsare numbered from the start of the predicted maturetranscript, E1. Transmembrane Proline Function in CL  21   a  t  A S P E T  J   o ur n a l   s  on J   a n u a r  y1  8  ,2  0 1  7 m ol   ph  a r m . a  s  p e  t   j   o ur n a l   s  . or  gD o wnl   o a  d  e  d f  r  om   less otherwise specified, chemicals were from Sigma (Poole, Dor-set, UK) or Fisher (Loughborough, UK). Cell culture reagentswere from Invitrogen (Paisley, Renfrewshire, UK) or Sigma.  125 I-iodohistidyl 8 -human   CGRP (2000 Ci/mmol) was from AmershamBiosciences (Little Chalfont, Buckinghamshire, UK),  125 I-iodohistidyl 8 -human   CGRP 8–37  (2000 Ci/mmol) was fromPerkinElmer Life and Analytical Sciences (Cambridge, UK) and[ 3 H]BIBN4096BS (105 Ci/mmol) was synthesized as describedpreviously (Wu et al., 2000; Schindler and Doods, 2002). Expression Constructs and Mutagenesis.  Human CL with anN-terminalhemagglutinin(HA)epitopetag(YPYDVPDYA)(McLatchieet al., 1998) and human RAMPs were provided by Dr. S. M. Foord(GlaxoSmithKline, Uxbridge, Middlesex, UK). CL was subcloned intopcDNA3- (Invitrogen, Renfrew, UK) before mutagenesis. Introductionof the epitope makes essentially no difference to the pharmacology of the receptor (McLatchie et al., 1998).Mutagenesis was carried out using the QuikChange site-directedmutagenesis kit (Stratagene, Cambridge, UK) according to the man-ufacturer’s instructions. Forward and reverse oligonucleotide prim-ers were designed with single base changes to incorporate amino acidpoint mutations from proline to alanine in the final CL protein andto engineer restriction sites to aid screening of mutants. The primerswere synthesized by Invitrogen: the sequences were as shown inTable 1.Plasmid DNA was extracted from cultures using a Wizard-PrepDNA extraction kit according to the manufacturer’s instructions(Promega, Southampton, UK). The plasmid DNA was eluted in 100  l of sterile distilled water and stored at   20°C. Sequences wereconfirmed by sequencing (Alta-Biosciences, Birmingham, UK). Cell Culture and Transfection.  COS-7 cells were cultured inDulbecco’s modified Eagle’s medium supplemented with 10% (v/v)fetal bovine serum and 5% (v/v) penicillin/streptomycin in a humid-ified 95% air/5% CO 2  atmosphere. For transfection, the cells wereplated onto either 48 well plates or 100 mm dishes. Cells weretransfected using a CalPhos kit (CLONTECH, Basingstoke, UK)according to the manufacturers instructions. 48 well plates weretreated with 1   g DNA per well and 100 mm dishes were treatedwith 10   g DNA/dish. Characterization of expressed receptors wasperformed 48–72h after transfection. MembranePreparation. The cells from each 100 mm plate werewashed briefly with 1 ml of cold phosphate-buffered saline andscraped into a small volume of buffer (20 mM HEPES, 2 mM MgCl 2 ,1% (w/v) bovine serum albumin (BSA), pH 7.5). The cells werehomogenized using an Ultra Turrax homogenizer (full speed for 20s).The cells were then centrifuged at 20,000  g  for 30 min at 4°C. Thesupernatant was removed and the pellets resuspended in 14 ml of buffer (as before) and used immediately for binding studies or storedat  70°C. Radioligand Binding.  For CGRP binding, membranes were ho-mogenized briefly before use and 500   l were incubated with 100 pMof either  125 I-iodohistidyl 8 -human   CGRP or  125 I-iodohistidyl 8 -hu-man   CGRP 8–37  and appropriate dilutions of human   CGRP orhuman   CGRP 8–37  for 60 min at room temperature. Nonspecificbinding was measured in the presence of 1   M CGRP. The sampleswere then centrifuged at 12,000  g  in a bench-top microcentrifuge for5 min at room temperature. The pellets were washed twice withwater and the radioactivity counted in a     counter.Binding with [ 3 H]BIBN4096BS was performed as described pre- viously (Schindler and Doods, 2002).  Assay of cAMP Production.  Growth medium was removed fromthe cells and replaced with Dulbecco’s modified Eagle’s mediumcontaining 500   M 3-isobutyl-1-methylxanthine for 30 min. Alldrugs were diluted in the same medium. Agonists in the range 1 pMto 1   M were added for a further 15 min. Ice-cold ethanol [95–100%(v/v)] was used to extract cAMP, which was subsequently measuredby radio-receptor assay as described previously (Poyner et al., 1992).  Analysis of Cell-Surface Expression of Mutants by Enzyme-Linked Immunosorbent Assay.  Cells in 24-well plates were tran-siently transfected with wild-type (WT) or mutant HA-epitope–tagged human CL and/or RAMPs 1 to 3. The transfected cells weretreated with 3.7% formaldehyde for 15 min after aspiration of growthmedium. The cells were then washed three times with 0.5 ml of Tris-buffered saline. Nonspecific binding of the antibody was blockedwith 1% BSA in Tris-buffered saline for 45 min. The cells weretreated with 250   l of primary antibody [mouse anti-HA antibody12CA5 (Sigma) diluted 1:1000 in Tris-buffered saline with 1% BSA]for 1 h, and the cells were washed again three times with 0.5 ml of Tris-buffered saline. A further blocking step was performed for 15min before the cells were incubated with 250   l of secondary anti-body [anti-mouse, alkaline phosphatase conjugated (Sigma), diluted1:1000 in Tris-buffered saline] for 1h. The cells were washed afurther three times before development with alkaline phosphatasetablets (Bio-Rad, Hemel Hempstead, UK) according to the manufac-turer’s instructions. Reactions were terminated with 100   l/well of 0.4 M NaOH. The absorbance measured by ELISA showed a lineardependence on the DNA concentration used in the transfection. Data Analysis.  Curve fitting was done with Prism (Graphpad Soft-ware Inc., San Diego, CA). For cAMP studies, the data from eachconcentration-response curve were fitted to a sigmoidal concentration-response curve to obtain the maximum response, Hill coefficient, andEC 50 . For displacement radioligand binding experiments, curves werefitted to obtain maximum and minimum amounts of binding, Hill coef-ficient,andIC 50 .Becausetheradioligandwaspresentatconcentrationswell below its  K  d , the IC 50  values were effectively identical to the  K  i  values.Toestimate  B max  valueswith 125 I-CGRP,thedatawerefittedtoa sigmoidal curve, calculating the amount bound from the specificactivity of the radioligand (this was progressively reduced by dilutionwith unlabeled CGRP). For saturation binding studies with[ 3 H]BIBN4096BS,thedatawerefittedtoasigmoidalcurvetoobtain  K  d and  B max  as described previously (Schindler and Doods, 2002). TABLE 1Primers Bases altered to create the Pro-to-Ala mutants are bold; bases altered to create restriction sites are italic; altered codons are underlined. The numbering of the residuesassumes a 22-amino acid signal protein before the start of the mature transcript (Fig. 1). P241A Forward  5  -GGCTGGGGATTT G CACTGATTCCTGCTTGTATACATGCCATTGCTAGAAG T  TTATATTAC-3  Reverse  3  -GTAATATAAACTTCTAGCAATGGCATGTATACACGAAGGAATCAGTGCAAATCCCCAGCC-5  P244A Forward  5  -GGATTTCCACTGATT G CTGCTTGTATACATGCCATTGCTAGA AGT  TTATATTAC-3  Reverse  3  -GTAATATAAACTTCTAGCAATGGCATGTATACAAGCAGCAATCAGTGGAAATCC-5  P275A Forward  5  -CCTCTACATTATCCA C  GGCGC  A  ATTTGTGCTGC-3  Reverse  3  -GCAGCACAAATTGCGCCGTGGATAATGTAGAGG-5  P321A Forward  5  -CTCTTATCTTGGTG G CATTGCTTGGCATTGAATTTGTGCTGATTCC C  TGGCGACCTG-3  Reverse  3  -CAGGTCGCCAGGGAATCAGCACAAATTCAATGCCAAGCAATGCCACCAAGATAAGAG-5  P331A Forward  5  -GAATTTGTGCTGATT G CATGGCGACCTGAAGG-3  Reverse  3  -CCTTCAGGTCGCCATGCAATCAGCACAAATTC-5  22  Conner et al.   a  t  A S P E T  J   o ur n a l   s  on J   a n u a r  y1  8  ,2  0 1  7 m ol   ph  a r m . a  s  p e  t   j   o ur n a l   s  . or  gD o wnl   o a  d  e  d f  r  om   pEC 50  or pIC 50  values were compared between WT and mutantdata from concomitantly transfected cells. A control WT experi-ment was always performed alongside a mutant experiment. Sta-tistical evaluation was either by Student’s  t  test when two valueswere compared or one-way analysis of variance followed byTukey’s test when multiple comparisons were made. Normalizedmutant cell-surface expression data were compared with theKruskal Wallis test followed by Dunn’s test.  B max  values werecompared against each other with one-way analysis of variancefollowed by Tukey’s test. Fig. 2.  CGRP-stimulated cAMP re-sponse of the proline mutants com-pared with WT. COS-7 cells weretransfected with WT/RAMP1 or mu-tant/RAMP1 and assayed for CGRP-stimulated cAMP production: P241A (A), P244A (B), P275A (C), P321A (D),and P331A (E).  f , WT receptors;   ,mutant receptors. Data are represen-tative of three to four similar experi-ments. Points are mean    S.E.M. of triplicate points.TABLE 2Binding and functional parameters of WT/RAMP1 and mutant receptors  Values are presented as mean  S.E.M.; the number of determinations is shown in parentheses.  E max  is the maximum response expressed as a percentage of the responseto the WT receptor.MutationCGRP binding (pIC 50 )Stimulation of cAMPWT/RAMP1pEC 50 Mutant/RAMP1WT/RAMP1 Mutant/RAMP1 pEC 50  E max % P241A 8.66  0.20 (6) 8.80  0.13 (6) 9.15  0.37 (3) 8.79  0.54 (3) 97  7 (3)P244A 8.31  0.37 (4) 8.64  0.36 (4) 9.05  0.16 (4) 9.01  0.2 (4) 112  7 (3)P275A 8.86  0.31 (6) 8.91  0.17 (3) 9.8  0.18 (3) 9.56  0.37 (3) 97  2 (3)P321A 8.84  0.31 (5) 7.69  0.21*(5) 9.18  0.46 (3) 6.86  0.2 (3)** 59  12 (3)P331A 9.18  0.33 (7) 8.65  0.24(7) † 9.57  0.22 (4) 8.54  0.25 (4)* 121  11 (3) * Significantly different from WT,  P  0.05, unpaired  t  test** Significantly different from WT,  P  0.01, unpaired  t  test. † Significantly different from WT,  P  0.05, paired  t  test. Transmembrane Proline Function in CL  23   a  t  A S P E T  J   o ur n a l   s  on J   a n u a r  y1  8  ,2  0 1  7 m ol   ph  a r m . a  s  p e  t   j   o ur n a l   s  . or  gD o wnl   o a  d  e  d f  r  om   Modeling of CL.  Family B receptors showing most homology toCL were aligned and used to predict the locations of the putative TMhelices. From these results a “cold spot” approach was used as aninitial basis for alignment with rhodopsin (Frimurer and Bywater1999). Periodicity analysis (Finer-Moore and Stroud, 1984) was thenused to further refine the alignment between rhodopsin and CL. A  Fig. 3.  Displacement of   125 I-CGRP byunlabeled CGRP at the proline mu-tants compared with WT. COS-7 cellswere transfected with WT/RAMP1 ormutant/RAMP1 and membranes wereassayed for  125 I-CGRP binding: P241A (A), P244A (B), P275A (C), P321A (D),and P331A (E).  f , WT receptors;   ,mutant receptors. Data are represen-tative of three to four similar experi-ments. Points are mean    S.E.M. of triplicate points.TABLE 3Expression of receptors  Values are presented as mean  S.E.M.; the number of determinations is shown in parentheses. Ab max  is the relative cell surface expression of receptors as measured bydetection of HA tags in an ELISA. Data normalized to WT as 100%. There is no significant difference between any value compared with WT (one-way analysis of variancefollowed by Dunnett’s test).Mutant  B max  Ab max125 I-CGRP   3 H  BIBN4096BS  pmol/mg WT 1.93  0.40 (24) 2.99  0.02 (3) 100 (3)P241A 1.13  0.43 (6) N.D. 112  20 (3)P244A 1.72  0.93 (4) N.D. 131  20 (3)P275A 0.57  0.14 (5) N.D. 121  24 (3)P321A 2.84  0.52 (3) 2.33  0.24 (3) 107  24 (3)P331A 1.75  0.59 (7) N.D. 138  15 (3) N.D., not determined. 24  Conner et al.   a  t  A S P E T  J   o ur n a l   s  on J   a n u a r  y1  8  ,2  0 1  7 m ol   ph  a r m . a  s  p e  t   j   o ur n a l   s  . or  gD o wnl   o a  d  e  d f  r  om 
Related Documents
View more...
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks
SAVE OUR EARTH

We need your sign to support Project to invent "SMART AND CONTROLLABLE REFLECTIVE BALLOONS" to cover the Sun and Save Our Earth.

More details...

Sign Now!

We are very appreciated for your Prompt Action!

x