Journals

12 pages
6 views

A Molecular Genetics Laboratory Course Applying Bioinformatics and Cell Biology in the Context of Original Research

Please download to get full document.

View again

of 12
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Share
Description
A Molecular Genetics Laboratory Course Applying Bioinformatics and Cell Biology in the Context of Original Research
Transcript
   Article A Molecular Genetics Laboratory Course ApplyingBioinformatics and Cell Biology in the Context of OriginalResearch Cynthia J. Brame,* Wendy M. Pruitt, † and Lucy C. Robinson ‡ *Department of Biology, Centenary College of Louisiana, Shreveport, LA 71105; and  † Departmentsof Molecular and Cellular Physiology and  ‡ Biochemistry and Molecular Biology, Louisiana State UniversityHealth Sciences Center, Shreveport, LA 71105 Submitted July 7, 2008; Revised August 31, 2008; Accepted September 18, 2008Monitoring Editor: Robin Wright Research-based laboratory courses have been shown to stimulate student interest in science andto improve scientific skills. We describe here a project developed for a semester-long research- based laboratory course that accompanies a genetics lecture course. The project was designed toallow students to become familiar with the use of bioinformatics tools and molecular biology andgenetic approaches while carrying out srcinal research. Students were required to present theirhypotheses, experiments, and results in a comprehensive lab report. The lab project concernedthe yeast casein kinase 1 (CK1) protein kinase Yck2. CK1 protein kinases are present in allorganisms and are well conserved in primary structure. These enzymes display sequencefeatures that differ from other protein kinase subfamilies. Students identified such sequenceswithin the CK1 subfamily, chose a sequence to analyze, used available structural data todetermine possible functions for their sequences, and designed mutations within the sequences.After generating the mutant alleles, these were expressed in yeast and tested for function byusing two growth assays. The student response to the project was positive, both in terms of knowledge and skills increases and interest in research, and several students are continuing theanalysis of mutant alleles as summer projects. INTRODUCTION Various organizations examining science education haveconcluded that an inquiry-based approach to learning isessential to understanding science as a process (HowardHughes Medical Institute, 1996; Council on UndergraduateResearch, 1997; National Research Council [NRC], 2003). Asa consequence, many laboratory courses have shifted awayfrom “cookbook” exercises toward an inquiry-based model,allowing students to feel the self-investment and excitementthat comes with discovery of new knowledge (Stukus andLennox, 2001; Eberhardt  et al ., 2003; Mitchell and Graziano,2006). Multiweek, inquiry- or research-based projects have been demonstrated to be an effective means of stimulatingstudent interest and enhancing skills in experimental designand interpretation (Myers and Burgess, 2003; Gammie andErdeniz, 2004; Howard and Miskowski, 2005; Mitchell andGraziano, 2006; Goyette and DeLuca, 2007). In addition,there is an increasing need to incorporate the use of bioin-formatics tools into such projects and into undergraduate biology classes in general (NRC, 2003).Here, we report a semester-long research project that re-quires students to use bioinformatics tools to design andinterpret a molecular biology-based experiment investigat-ing structural determinants of protein kinase activity. Ourgoals for the course were to allow students to experience theexcitement and challenges of srcinal research while increas-ing their ability to understand and use the tools of themodern molecular biologist. Our specific learning objectiveswere as follows:1. Students will gain understanding of genetics conceptsand molecular biology techniques through using them inthe context of a multi-step research project;2. Students will learn to use protein and nucleotide data- DOI: 10.1187/cbe.08–07–0036Address correspondence to: Cynthia J. Brame (cbrame@centenary.edu).CBE—Life Sciences EducationVol. 7, 410–421, Winter 2008410 © 2008 by The American Society for Cell Biology  by guest on March 3, 2014http://www.lifescied.org/ Downloaded from  http://www.lifescied.org/content/suppl/2008/11/19/7.4.410.DC1.htmlSupplemental Material can be found at:   bases and bioinformatics tools to investigate conservedprotein features; and3. Students will demonstrate increased ability to analyzeand communicate the results of a multi-step project.The results from a knowledge survey administered at the beginning and end of the semester indicate that learningobjectives 1 and 2 were met, whereas assessment of labreports over the course of the semester indicated that objec-tive 3 was met. In addition, student perceptions of theproject indicate that they felt the process facilitated theirlearning. Background for the Research Project  This project focuses on casein kinase 1 (CK1) protein kinases,using the yeast enzyme Yck2 as a model CK1. The CK1subfamily of protein kinases comprises a diverse group of kinases found in all eukaryotic cells. CK1 protein kinasesfrom multicellular organisms regulate processes, includingsynaptic transmission (Faundez and Kelly, 2000), receptorsignaling (Tobin  et al ., 1997), circadian rhythm (Lee  et al .,2001), DNA repair (Knippschild  et al ., 1997), nuclear import(Vielhaber  et al ., 2000), and cell division (Brockman  et al .,1992). CK1 activities also have been implicated with roles inneurodegenerative diseases, including Alzheimer’s disease,and could be involved in a variety of cancers (Schwab  et al .,2000; Rubinfeld  et al ., 2001). CK1 enzymes phosphorylate Seror Thr residues C-terminal to acidic residues. The classicalsite for CK1 is Asp/Glu-X-X-Ser/Thr (Tuazon and Traugh,1991), but it has been demonstrated that P  Ser/P  Thr-X-X-Ser/Thr provides high-affinity CK1 recognition for thedownstream Ser/Thr residue (Flotow and Roach, 1989).Yck2 together with Yck1 forms a pair of essential andredundant kinases in the budding yeast  Saccharomyces cer-evisiae  (Robinson  et al ., 1993; Vancura  et al ., 1993). The Yckproteins are essential for cell division and viability, and inaddition to other functions, they seem to be involved inmembrane protein turnover, bud site selection, polarizationof the actin cytoskeleton, and function of the septin ring thatis essential for cytokinesis in yeast (Robinson  et al ., 1993;Panek  et al ., 1997; Robinson  et al ., 1999; Marchal  et al ., 2002).In accord with functions at the plasma membrane, Yck2 wasfound to be a peripheral membrane protein of approxi-mately 62 kDa (Vancura  et al ., 1993). Yck2 is anchored to themembrane via palmitoylation of its two terminal cysteineresidues (Roth  et al ., 2002; Babu  et al ., 2004). Targeting to theplasma membrane (as opposed to internal membranes) re-quires the 48 C-terminal residues that seem to be requiredsolely for palmitoylation (Babu  et al ., 2004).We used a previously generated green fluorescent protein(GFP)-tagged  YCK2  clone and two yeast strains to assess thefunction of the student-generated mutant alleles: a  yck  ts (  yck1::ura3 yck2–2 ts ) yeast strain in which  YCK1  is deletedand the yck2-2 ts gene product functions at 24°C but has littleactivity at 37°C (Robinson  et al ., 1993), and a  yck    strain(  yck1  ::KanMX  ,  yck2  ::NatMX  ) in which both  YCK1  and YCK2  have been deleted and Yck activity is provided by aplasmid-borne  YCK2  allele (  pRS316: YCK2; URA3 ). Thesetools, available on request, allowed easy manipulation of the YCK2  gene as well as two simple functionality assays. Allother molecular biology supplies we used are commerciallyavailable, and all bioinformatics tools we used are freelyavailable on the World Wide Web. Course Context  This project was implemented in Biology 313 (BIOL 313,Genetics) at Centenary College of Louisiana. BIOL 313 is asurvey genetics course that is required for all biology majorsand is taken by most biochemistry and biophysics majors.The course enrolls between 40 and 50 students each spring,and consists of 3 h of lecture and 3 h of lab each week for 14wk. There are typically three lab sections, limited to a max-imum of 18 students per section. Approximately one-third of the students taking the course are sophomores, approxi-mately 40% are juniors, and approximately one-fourth areseniors. All students taking the course have completed twosemesters of general chemistry and a one-semester introduc-tory cell biology course; many are concurrently enrolled inthe second semester of organic chemistry. Because the lec-ture section of the course covers a broad range of topics,ranging from classical genetics to molecular genetics, the labproject proceeds independently of the lecture section of thecourse. The instructors refer to the lab project wheneverrelevant topics (e.g., cloning) are covered in lecture, provid-ing students with concrete examples illustrating variouslecture topics. METHODS Preparation Each week, students received a document describing the purpose of the week’s activity, the techniques used for the activity, and anyother background information needed. Students were expected toread these documents before attending lab. These documents areavailable as Supplementary Material 1.  Identifying Conserved Sequences in CK1 Enzymes The instructor reviewed conserved features of protein kinases witheach lab section based on three reviews, all of which were madeavailable for students’ reference (Hanks  et al ., 1988; Hanks andHunter, 1995; Hanks, 2003). After reviewing the concepts of con-served sequences and protein families, students identified con-served amino acid sequences in CK1 enzymes of at least six aminoacids. Specifically, students obtained sequences of CK1 enzymesfrom the National Center for Biotechnology Information (NCBI)protein database (www.ncbi.nlm.nih.gov/sites/entrez), choosing atleast one   , one   , and one     CK1 as well as the yeast enzymes Yck1and Yck2. Students aligned these protein sequences using ClustalW(align.genome.jp; Higgins and Sharp, 1988) and identified con-served sequences. The students consulted a table displaying con-served kinase sequences to determine whether these conservedsequences were specific to CK1 enzymes (Hanks and Hunter, 1988).To put the CK1-specific conserved sequences in context of CK1structure, the students used Cn3D and the NCBI Structure databaseto highlight the conserved sequences in a model CK1 (CK1 from Schizosaccharomyces pombe  complexed with Mg 2  -ATP; www.ncbi.nlm.nih.gov/structure). After identifying the ATP-binding lobe, thesubstrate-binding lobe, and each of the conserved sequences, thestudents formed hypotheses about the function of each conservedsequence. Each lab section then chose a single conserved sequenceon which to focus, and each lab group (composed of two to threestudents) determined the mutation within that sequence that theywished to make. The instructor encouraged the lab groups to worktogether in designing these mutations, suggesting that the muta-Yeast Mutagenesis Lab ProjectVol. 7, Winter 2008 411  by guest on March 3, 2014http://www.lifescied.org/ Downloaded from   tions could be more informative if different groups made comple-mentary mutations. For example, within a lab section focusing inpart on a highly conserved proline, one lab group deleted theproline, one made a conservative mutation, and one made a non-conservative mutation. Designing Primers Students obtained the  YCK2  open reading frame (ORF) sequencefrom the Saccharomyces Genome Database (www.yeastgenome-.org) and used this to identify the nucleotides corresponding to theirconserved amino acid sequence. Using rules for primer designprovided with the Stratagene QuikChange kit, students then de-signed primers to introduce their mutation. Specifically, studentsattempted to design primers that were between 25 and 45 nucleo-tides, with a melting temperature of   78°C, a minimum GC contentof 40%, and terminated in one or more C or G bases. The instructorexamined each pair of primers and suggested changes when appro-priate. When it was not possible to design primers that adhered to allthe desired parameters, the instructor often designed a second primerset to increase the probability of a successful mutagenesis reaction. Allprimers were synthesized by Integrated DNA Technologies (Cor-alville, IA) at the 100-nmol level and were used without purification. Site-directed Mutagenesis Mutagenesis reactions were performed using the QuikChange kitaccording to manufacturer’s instructions (Stratagene, Cedar Creek,TX). Unless otherwise noted, all reagents were provided with theQuikChange kit. Briefly, each student group performed two mu-tagenesis reactions, using 5 and 10 ng of pLR10 (pUC18: GFP - YCK2 ;Robinson  et al ., 1999) as template. The  GFP  fusion in this plasmidhas native  YCK2  flanking sequences upstream and downstream,including the native  YCK2  promoter (Robinson  et al ., 1999). Theforward and reverse primers (125 ng) designed by the students wereused in the reactions; when the instructors identified potentialshortcomings of the students’ primer design, students performedduplicate reactions with a primer set designed by the instructors.The reactions also contained reaction buffer, dNTP mix,  PfuTurbo DNA polymerase, and water to a final volume of 50   l. Reactionswere carried out in an Eppendorf thermal cycler as follows: 1 cycle:95°C 30 s; 18 cycles: 95°C 30 s, 55°C 1 min, 68°C 5 min. TemplateDNA was then digested by incubation with DpnI for 1 h at 37°C.XL-1 Blue supercompetent cells were thawed on ice and separatedinto 50-  l aliquots in prechilled 14-ml BD Falcon polypropyleneround-bottomed tubes (Thermo Fisher Scientific, Waltham, MA).Supercompetent cells were incubated with 1  l of each DpnI-treatedmutagenesis reaction for 30 min. The cells were heat-shocked at42°C for 45 s and then incubated on ice for 2 min. Preheated SOC broth was added and cells were incubated for 1 h at 37°C withshaking. Half the volume of each transformation reaction was thenplated on Luria-Bertani (LB)-ampicillin medium and incubated at37°C overnight. Each student group picked three colonies withsterile toothpicks and grew these in LB containing 100   g/ml am-picillin overnight at 37°C with shaking. Plasmid Preparation Plasmid minipreps were performed using the Zyppy Prep I mini-prep kit (Zymo Research, Orange, CA) according to manufacturer’sinstructions. Briefly, cells from 3 ml of liquid culture were pelleted by brief centrifugation in a 1.5-ml microfuge tube at full speed. Thesupernatant was discarded, and the cell pellet was resuspended in buffer P1 and lysed by addition of buffer P2. Buffer P3 was addedto precipitate cell debris. The tube was centrifuged for 3 min at fullspeed, and the supernatant was loaded into the Zymo-spin column,avoiding carrying over any cell debris. The Zymo-spin column andcollection tube were centrifuged at full speed for 30 s, allowing theliquid to flow through the column. The flow through in the collec-tion tube was discarded and the resin was washed with wash buffer.The column was transferred to a sterile 1.5-ml microfuge tube andDNA was eluted with 40   l of water.  Analytical Digest of Mutagenized DNA before Sequencing  Miniprep DNA was analyzed by restriction enzyme digest and gelelectrophoresis. One microliter of each sample was incubated with2 U of BamHI and 2 U of SalI in buffer D (all from Promega,Madison, WI) for 1 h at 37°C. The digested samples were thencombined with loading buffer (Sambrook  et al ., 1989), loaded in a1% agarose gel containing 1   g/ml ethidium bromide, and sub- jected to electrophoresis for approximately 1 h at 120 V. Resultswere visualized with UV light. Sequencing  Each student group chose three samples for sequence analysis.Approximately 1000 ng of DNA to be sequenced and approximately100 pmol of the appropriate sequencing primer were sent to Retro-gen (San Diego, CA) for automated dideoxy sequencing. Due to thehigh fidelity of   PfuTurbo  and the cost of multiple sequencing reac-tions for each clone, only the region of interest was sequenced foreach clone for the lab course. Mutations in the LLGPSLED regionused the sequencing primer 5  -GGGCTGCACTATAAGATAG-3  ,mutations in the HIPYRE region were analyzed with the sequencingprimer 5  -CTGTTGTACAAGTCG-3  , and mutations in the EQSRRDDregion were analyzed with the sequencing primer 5  -GGAAGAC-CGGGTCAACC-3   (all from Integrated DNA Technologies). Stu-dents analyzed the results of the sequencing using the BLASTalgorithm (Altschul  et al ., 1990). Specifically, they used BLAST toalign the sequences obtained from Retrogen with  YCK2  sequence.The alignment was used to verify that their mutant allele wasidentical to wild-type  YCK2  except at the mutation site. Preparative Digest to Isolate GFP-mYCK2 Fragment  Each student group chose one clone containing the desired muta-tion for further use and subjected it to a preparative digest toremove the  GFP-mYCK2  fragment from the vector. Specifically, 2–3  g of DNA was incubated for 2 h at 37°C in buffer H with 5 U eachXbaI and SacI (all from Promega) in a final volume of 25  l. Sampleswere then mixed with loading buffer, loaded in a 1% agarose gelcontaining 1   g/ml ethidium bromide, and electrophoresed as de-scribed above. Results were visualized with UV light, and the bandcorresponding to the  GFP - mYCK2  fragment was excised with ascalpel and stored at 4°C for purification. GFP-mYCK2 Fragment Purification Purification of the  GFP - mYCK2  fragments was performed using aWizard SV DNA purification kit (Promega, Madison, WI) accordingto manufacturer’s instructions. Briefly, the agarose gel slice wasmelted in membrane binding solution (MBS), by using 10   l of MBSfor every 10 mg of agarose, at 60°C. The dissolved gel was loadedinto an SV minicolumn and incubated for 1 min at room tempera-ture. After the incubation, the minicolumn was centrifuged for 1min at full speed. The liquid in the collection tube was discarded,and the column was washed twice with membrane wash solution.The SV minicolumn was transferred to a clean 1.5-ml microfugetube, and 50   l of water was added. The minicolumn was incubatedat room temperature for 1 min and then centrifuged at full speed for2 min to elute the purified GFP- mYCK2  fragment. Ligation To construct low copy plasmid containing  GFP - mYCK2  under thecontrol of the native  YCK2  promoter, the purified  GFP - mYCK2 fragment was ligated into pRS315 ( CEN  ,  LEU2 ; Sikorski and Hieter,1989). Ligation was performed using a LigaFast kit (Promega) ac-cording to manufacturer’s instructions. Students incubated 100 ngof   GFP-mYCK2  with 70 ng of XbaI/SacI-digested pRS315 shuttlevector in a 16-  l reaction with 3 U of DNA ligase. Reactions wereincubated for 10 min at room temperature and then used to trans-form 100   l of chemically competent DH5   Escherichia coli  cells.Frozen competent cells were thawed on ice, and 100   l was incu- bated with the ligation mixture on ice for 30 min. The cells wereC. J. Brame  et al .CBE—Life Sciences Education412  by guest on March 3, 2014http://www.lifescied.org/ Downloaded from   heat-shocked at 42°C for 3 min and then incubated on ice for 2 min.The cells were then incubated with 0.5 ml of preheated LB for 1 h at37°C with shaking. Next, 250   l of each reaction was plated onLB-ampicillin plates and incubated at 37°C overnight. After devel-opment of colonies, colonies were inoculated into LB plus 0.1%ampicillin and incubated overnight at 37°C with shaking. Eachstudent group grew four liquid cultures and purified plasmid DNAfrom each using the miniprep procedure described above.  Analytical Digest of Shuttle Vector: GFP-mYCK2 Construct  Miniprep results were analyzed by restriction digest and gel elec-trophoresis. One microliter of each sample was incubated in a totalvolume of 10   l with 2 U of XbaI and 2 U of SacI in buffer H (allfrom Promega) for 1 h at 37°C. Reactions were then combined withloading buffer and electrophoresed as described above. Resultswere visualized with UV light. Preparation of Calf Thymus Carrier DNA Calf thymus DNA (Sigma-Aldrich, St. Louis, MO) was prepared asa 10 mg/ml solution in TE and sheared sequentially with 18-, 22-,and 26-gauge needles. The solution was then autoclaved for 15 min before incubating on ice for 10 min. Aliquots were stored at  20°C.Each aliquot was boiled for 10 min and then placed on ice imme-diately before use. Preparation of Yeast Media and Plates Media were prepared as described previously (Sherman  et al .,1986). Yeast Transformation and Culture Students used a modified version of the LiOAc transformationprocedure of Gietz and Schiestl (1991). For each pair of studentgroups, 10 ml YPD cultures were inoculated with  yck  ts yeast(  yck1-  1::ura3 yck2-2 ts ; Robinson  et al ., 1999) and  yck    yeast andgrown overnight at 24°C with shaking. Approximately 3 h beforeuse, each culture was diluted to 100 ml in YPD and grown at 24°Cwith shaking. Cells were then pelleted by low-speed centrifugationand the cell pellet was washed with sterile water and resuspendedin lithium acetate in TE (0.1 M LiOAc/TE). One hundred microliteraliquots of the competent cells were added to prechilled microfugetubes containing 75   g of calf thymus DNA and 2   g of pRS315: GFP - mYCK2 . Each student group carried out a no DNA control (noplasmid), a positive control (2   g pRS315: GFP - YCK2 ), and a nega-tive control (2  g pRS315). Then, 600  l of 40% polyethylene glycol/0.1 M lithium acetate in TE was added, followed by gentle mixing by inversion. The tubes were then incubated at room temperaturefor 30 min on a rotating platform. Dimethylsulfoxide (70   l) wasthen added to each sample, and each sample was mixed by inver-sion and then heat shocked at 42°C for 6 min. After rapid cooling for2 min on ice, cells were pelleted at 3000 rpm for 3 min, the super-natant was discarded, and the pellet was resuspended in 1 ml of   Leu medium. One tenth of each sample was then plated on a  Leu plate by using sterile 4-mm glass beads. The plates wereallowed to develop colonies for several days at room temperature(  yck  ts cells) or 30°C (  yck    cells). Four colonies from each reactionwere patched to   Leu plates and grown overnight at 24°C (  yck  ts cells) or at 30°C (y ck   cells). Patches were then replica plated to two  Leu plates incubated at 24 and 37°C (  yck  ts cells) or to   Leu and Figure 1.  Conserved amino acids in CK1s.ClustalW alignment of amino acid sequencesfrom five CK1 protein kinases (Yck2 from  S . cerevisiae , Yck1 from  S .  cerevisiae , CK1   from Xenopus laevis , CK1   from  Toxoplasma gondii ,and CK1    from  Xenopus tropicalis ). The stardesignations beneath a text column indicatecomplete conservation of the amino acid.Highlighted in yellow are the conserved se-quences LLGPSLED, HIPYRE, and EQSRRDD.(Left to right) Cn3D three-dimensional repre-sentations of CK1 from  Schizosaccharomyces pombe  bound to Mg 2  -ATP. The conserved se-quences identified above are highlighted belowin yellow (left to right, LLGPSLED, HIPYRE,and EQSRRDD).Yeast Mutagenesis Lab ProjectVol. 7, Winter 2008 413  by guest on March 3, 2014http://www.lifescied.org/ Downloaded from   5-fluoro-orotic acid (5-FOA) plates incubated at 30°C (  yck    cells).Function was assessed by comparing growth in permissive andrestrictive conditions. Visualization Yeast cells grown overnight on agar medium in restrictive condi-tions were scraped from patches, suspended in 2–5   l of water,placed under a coverslip, and examined by bright field and fluo-rescence microscopy.  Assessment  To determine whether educational goals 1 and 2 were achieved,student knowledge and skills were assessed with a pretest the firstday that the lab met. The same test also was included on the finalexam as a posttest. To compare responses to individual questions,student responses from each lab section were averaged. A two-tailed paired  t  test was performed to determine whether the learn-ing gain for each question was significant. To compare individualstudent learning on the entire test, a two-tailed paired  t  test wasperformed without regard to individual lab sections. The test isprovided in Supplemental Material 2.To determine whether educational goal 3 was achieved, studentlab reports were assessed using a rubric (provided in SupplementalMaterial 2). Students wrote a lab report at midterm detailing theirresults for the first half of the project. They were then allowed torevise this lab report to replace their initial grade. Students alsowrote a final lab report detailing the results for the second half of theproject, but they were unable to revise this report. Scores on the firstlab report were compared with the revision and to the second labreport; in both cases, the significance of the change was determinedwith a two-tailed paired  t  test.Students also completed an attitudes survey at the end of thecourse assessing their perceptions of the extent to which the labactivities facilitated their learning. RESULTS Overview of Project  Students worked in groups of two or three to identifyconserved amino acid sequences in CK1 protein kinases,visualize their locations on a CK1 structure by using theCn3D software (www.ncbi.nlm.nih.gov/Structure/CN3D/cn3d.shtml), and form hypotheses about the function of eachconserved sequence (Figure 1). Each lab section (composedof five to six student groups and as many as 18 students)then chose one conserved sequence with which to work anddevised mutations to investigate the function of this se-quence, with each student group focusing on a differentmutation. Each student group designed primers to generatetheir mutation within Yck2, a CK1 from budding yeast (Ta- ble 1). The primers were used with the QuikChange kit(Stratagene) to perform site-directed mutagenesis (Figure 2).The students verified generation of their desired mutantallele by nucleotide sequence analysis of the mutated region.The mutant alleles were then cloned into a yeast/ E .  coli shuttle vector and used to transform two strains of yeast, Table 1.  Student-designed mutations and mutagenic primers Conserved sequence Mutation Mutagenic primer (5  3  3  ; forward primer only) 151 LLGPSLED   LLGPSLED GGTTATTGATTTATTCGATTGG*ATATTGGTTATTGATTTATTCGATTGGTG  LLG GGTTATTGATCCTTCTTTAG*ATATTGGTTATTGATCCTTCTTTAGAAGAT  P GATCTGCTTGGTTCTTTAGAAG*GATCTGCTTGGTTCTTTAGAAGATTTA  PSLED GGTTATTGATCTGCTTGGTTTATTCGATTGGTGTGG*ATTGATCTGCTTGGTTTATTCGATTGGTGP 3  W GATCTGCTTGGTTGGTCTTTAGAAGATTTATTC*GATCTGCTTGGTTGGTCTTTAGAAGP 3  E GATCTGCTTGGTGAGTCTTTAGAAG 233 HIPYRE   P ACTAAACAACATATTTACAGGGAAAAGAAACTAAACAACATATTTACAGGGAAAAGP 3  V CTAAACAACATATTGTGTACAGGGAAAAGP 3  T CTAAACAACATATTACGTACAGGGAAAAGDY AACAACATATTCCGAGGGAAAAGAAATCY 3  F AAACAACATATTCCGTTCAGGGAAAAGAAATCY 3  S CAACATATTCCGTCGAGGGAAAAGAAA 258 EQSRRDD   EQS ACACATTTGGGTAGAAGAAGAGACGATATG  S TTGGGTAGAGAACAAAGAAGAGACGATATGS 3  T GGTAGAGAACAAACGAGAAGAGACGATATG*GGTAGAGAACAAACGAGAAGAGACGATS 3  C CATTTGGGTAGAGAACAATGCAGAAGAGACGATATGGAAGCT*TGGGTAGAGAACAATGCAGAAGAGACGATATGDD 3  NN GAACAATCGAGAAGAAACAATATGGAAGCTATGGRRDD 3  GGGG AGAGAACAATCGGGAGGAGGCGGTATGGAAGCTATThe numbering for the conserved sequences corresponds to Yck2 amino acid sequence. The forward primers for site-directed mutagenesisdesigned by students and by instructors (*) are shown. It was not possible to design primers for the  151 LLGPSLED region that correspondedto all the desired parameters; thus, in most cases, the instructors provided a second set of primers to increase the probability of a successfulmutagenesis reaction.C. J. Brame  et al .CBE—Life Sciences Education414  by guest on March 3, 2014http://www.lifescied.org/ Downloaded from 
Related Documents
View more...
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks
SAVE OUR EARTH

We need your sign to support Project to invent "SMART AND CONTROLLABLE REFLECTIVE BALLOONS" to cover the Sun and Save Our Earth.

More details...

Sign Now!

We are very appreciated for your Prompt Action!

x